ID: 942786337 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:179706668-179706690 |
| Sequence | GGGTTGAAACTGACTGAGCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942786332_942786337 | 15 | Left | 942786332 | 2:179706630-179706652 | CCCTGAAAACACTGAAGGTTCAG | No data | ||
| Right | 942786337 | 2:179706668-179706690 | GGGTTGAAACTGACTGAGCAAGG | No data | ||||
| 942786333_942786337 | 14 | Left | 942786333 | 2:179706631-179706653 | CCTGAAAACACTGAAGGTTCAGA | No data | ||
| Right | 942786337 | 2:179706668-179706690 | GGGTTGAAACTGACTGAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942786337 | Original CRISPR | GGGTTGAAACTGACTGAGCA AGG | Intronic | ||
| No off target data available for this crispr | |||||