ID: 942786337

View in Genome Browser
Species Human (GRCh38)
Location 2:179706668-179706690
Sequence GGGTTGAAACTGACTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942786332_942786337 15 Left 942786332 2:179706630-179706652 CCCTGAAAACACTGAAGGTTCAG No data
Right 942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG No data
942786333_942786337 14 Left 942786333 2:179706631-179706653 CCTGAAAACACTGAAGGTTCAGA No data
Right 942786337 2:179706668-179706690 GGGTTGAAACTGACTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942786337 Original CRISPR GGGTTGAAACTGACTGAGCA AGG Intronic
No off target data available for this crispr