ID: 942794448

View in Genome Browser
Species Human (GRCh38)
Location 2:179800985-179801007
Sequence GCTTCAAAATAGTCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942794444_942794448 5 Left 942794444 2:179800957-179800979 CCCAATTCATAAGCAAAGTTTCC No data
Right 942794448 2:179800985-179801007 GCTTCAAAATAGTCACCTCAGGG No data
942794443_942794448 23 Left 942794443 2:179800939-179800961 CCTTGATTTCATCTGTTACCCAA No data
Right 942794448 2:179800985-179801007 GCTTCAAAATAGTCACCTCAGGG No data
942794445_942794448 4 Left 942794445 2:179800958-179800980 CCAATTCATAAGCAAAGTTTCCT No data
Right 942794448 2:179800985-179801007 GCTTCAAAATAGTCACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942794448 Original CRISPR GCTTCAAAATAGTCACCTCA GGG Intronic
No off target data available for this crispr