ID: 942799402

View in Genome Browser
Species Human (GRCh38)
Location 2:179859780-179859802
Sequence TGCTGTATTTTGCATTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942799401_942799402 -1 Left 942799401 2:179859758-179859780 CCTCAAGTAACAGAACTTGCAAT No data
Right 942799402 2:179859780-179859802 TGCTGTATTTTGCATTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942799402 Original CRISPR TGCTGTATTTTGCATTCTAA AGG Intronic
No off target data available for this crispr