ID: 942802556

View in Genome Browser
Species Human (GRCh38)
Location 2:179892413-179892435
Sequence GTGCCCATCCTTACTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942802556_942802557 4 Left 942802556 2:179892413-179892435 CCAATCTCAGTAAGGATGGGCAC No data
Right 942802557 2:179892440-179892462 AATCACCAAGCCTTGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942802556 Original CRISPR GTGCCCATCCTTACTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr