ID: 942812339

View in Genome Browser
Species Human (GRCh38)
Location 2:180013925-180013947
Sequence GCAGATACTGAGATAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942812336_942812339 12 Left 942812336 2:180013890-180013912 CCTGGAATCACTGTATCAATTGG No data
Right 942812339 2:180013925-180013947 GCAGATACTGAGATAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942812339 Original CRISPR GCAGATACTGAGATAGAAAC AGG Intergenic
No off target data available for this crispr