ID: 942813418

View in Genome Browser
Species Human (GRCh38)
Location 2:180023375-180023397
Sequence ACAAAATACATTGAGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942813418_942813426 21 Left 942813418 2:180023375-180023397 CCTGGATTCTCAATGTATTTTGT No data
Right 942813426 2:180023419-180023441 AGAAAAAGGAGCATGATGCTGGG No data
942813418_942813427 22 Left 942813418 2:180023375-180023397 CCTGGATTCTCAATGTATTTTGT No data
Right 942813427 2:180023420-180023442 GAAAAAGGAGCATGATGCTGGGG No data
942813418_942813425 20 Left 942813418 2:180023375-180023397 CCTGGATTCTCAATGTATTTTGT No data
Right 942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG No data
942813418_942813421 7 Left 942813418 2:180023375-180023397 CCTGGATTCTCAATGTATTTTGT No data
Right 942813421 2:180023405-180023427 GGTACTCCCATTCCAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942813418 Original CRISPR ACAAAATACATTGAGAATCC AGG (reversed) Intergenic
No off target data available for this crispr