ID: 942813425

View in Genome Browser
Species Human (GRCh38)
Location 2:180023418-180023440
Sequence CAGAAAAAGGAGCATGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942813418_942813425 20 Left 942813418 2:180023375-180023397 CCTGGATTCTCAATGTATTTTGT No data
Right 942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942813425 Original CRISPR CAGAAAAAGGAGCATGATGC TGG Intergenic
No off target data available for this crispr