ID: 942817734

View in Genome Browser
Species Human (GRCh38)
Location 2:180071735-180071757
Sequence AGCCCTGTGCTGTTCCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942817734_942817736 20 Left 942817734 2:180071735-180071757 CCACTAAGGAACAGCACAGGGCT No data
Right 942817736 2:180071778-180071800 TGATATGTAAGAGATCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942817734 Original CRISPR AGCCCTGTGCTGTTCCTTAG TGG (reversed) Intergenic
No off target data available for this crispr