ID: 942819215

View in Genome Browser
Species Human (GRCh38)
Location 2:180091400-180091422
Sequence ACATCAGCAGCCATATTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942819214_942819215 0 Left 942819214 2:180091377-180091399 CCAATAAAAGTGAACTTGGTGTG No data
Right 942819215 2:180091400-180091422 ACATCAGCAGCCATATTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942819215 Original CRISPR ACATCAGCAGCCATATTTAA CGG Intergenic
No off target data available for this crispr