ID: 942824852

View in Genome Browser
Species Human (GRCh38)
Location 2:180163314-180163336
Sequence AACAGAAGGCGGCCCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942824852_942824856 1 Left 942824852 2:180163314-180163336 CCATTCCTGGGCCGCCTTCTGTT No data
Right 942824856 2:180163338-180163360 ACACTTTTCTACCTTGACCATGG No data
942824852_942824857 2 Left 942824852 2:180163314-180163336 CCATTCCTGGGCCGCCTTCTGTT No data
Right 942824857 2:180163339-180163361 CACTTTTCTACCTTGACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942824852 Original CRISPR AACAGAAGGCGGCCCAGGAA TGG (reversed) Intergenic
No off target data available for this crispr