ID: 942828332

View in Genome Browser
Species Human (GRCh38)
Location 2:180207870-180207892
Sequence TAGGCAACCCATTCTAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942828330_942828332 12 Left 942828330 2:180207835-180207857 CCTGCTTGAACACATTACATGGA No data
Right 942828332 2:180207870-180207892 TAGGCAACCCATTCTAGTGTTGG No data
942828328_942828332 29 Left 942828328 2:180207818-180207840 CCTTTTGCAACATTCTTCCTGCT No data
Right 942828332 2:180207870-180207892 TAGGCAACCCATTCTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942828332 Original CRISPR TAGGCAACCCATTCTAGTGT TGG Intergenic
No off target data available for this crispr