ID: 942828477

View in Genome Browser
Species Human (GRCh38)
Location 2:180209847-180209869
Sequence CATTGGTACTATAGTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942828473_942828477 -10 Left 942828473 2:180209834-180209856 CCCATGTGGCATCCATTGGTACT No data
Right 942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG No data
942828468_942828477 27 Left 942828468 2:180209797-180209819 CCTTGTTACTGCTGGGTGGGAGT No data
Right 942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG No data
942828472_942828477 -9 Left 942828472 2:180209833-180209855 CCCCATGTGGCATCCATTGGTAC No data
Right 942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942828477 Original CRISPR CATTGGTACTATAGTGAAGG TGG Intergenic
No off target data available for this crispr