ID: 942830304

View in Genome Browser
Species Human (GRCh38)
Location 2:180232054-180232076
Sequence TGGCGAATGGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942830304_942830313 23 Left 942830304 2:180232054-180232076 CCATCCACCACTGCCATTCGCCA No data
Right 942830313 2:180232100-180232122 TCCACCCCTCAGGGTCCGTCAGG No data
942830304_942830315 24 Left 942830304 2:180232054-180232076 CCATCCACCACTGCCATTCGCCA No data
Right 942830315 2:180232101-180232123 CCACCCCTCAGGGTCCGTCAGGG No data
942830304_942830312 14 Left 942830304 2:180232054-180232076 CCATCCACCACTGCCATTCGCCA No data
Right 942830312 2:180232091-180232113 CCATTGACTTCCACCCCTCAGGG No data
942830304_942830310 13 Left 942830304 2:180232054-180232076 CCATCCACCACTGCCATTCGCCA No data
Right 942830310 2:180232090-180232112 GCCATTGACTTCCACCCCTCAGG 0: 4
1: 32
2: 85
3: 96
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942830304 Original CRISPR TGGCGAATGGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr