ID: 942830989

View in Genome Browser
Species Human (GRCh38)
Location 2:180237390-180237412
Sequence CCCAGCGGGTACCCGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942830989_942830999 6 Left 942830989 2:180237390-180237412 CCAGACTCCGGGTACCCGCTGGG No data
Right 942830999 2:180237419-180237441 GGGGCTGGTTTCCCCAACAATGG No data
942830989_942830997 -9 Left 942830989 2:180237390-180237412 CCAGACTCCGGGTACCCGCTGGG No data
Right 942830997 2:180237404-180237426 CCCGCTGGGTGGTGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942830989 Original CRISPR CCCAGCGGGTACCCGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr