ID: 942831223

View in Genome Browser
Species Human (GRCh38)
Location 2:180238913-180238935
Sequence TGTTGAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942831223_942831228 13 Left 942831223 2:180238913-180238935 CCGTCCACCACTGCTGTTCAACA No data
Right 942831228 2:180238949-180238971 ACCATTGACTTCCACCCCTCCGG No data
942831223_942831231 24 Left 942831223 2:180238913-180238935 CCGTCCACCACTGCTGTTCAACA No data
Right 942831231 2:180238960-180238982 CCACCCCTCCGGATCTGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942831223 Original CRISPR TGTTGAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr