ID: 942831223 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:180238913-180238935 |
| Sequence | TGTTGAACAGCAGTGGTGGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942831223_942831228 | 13 | Left | 942831223 | 2:180238913-180238935 | CCGTCCACCACTGCTGTTCAACA | No data | ||
| Right | 942831228 | 2:180238949-180238971 | ACCATTGACTTCCACCCCTCCGG | No data | ||||
| 942831223_942831231 | 24 | Left | 942831223 | 2:180238913-180238935 | CCGTCCACCACTGCTGTTCAACA | No data | ||
| Right | 942831231 | 2:180238960-180238982 | CCACCCCTCCGGATCTGTCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942831223 | Original CRISPR | TGTTGAACAGCAGTGGTGGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||