ID: 942831451

View in Genome Browser
Species Human (GRCh38)
Location 2:180241091-180241113
Sequence GGTGTCATGAGATGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942831451_942831454 1 Left 942831451 2:180241091-180241113 CCAGCTTTTCATCTCATGACACC No data
Right 942831454 2:180241115-180241137 TGGCTTGATACTTAAACCTATGG No data
942831451_942831455 9 Left 942831451 2:180241091-180241113 CCAGCTTTTCATCTCATGACACC No data
Right 942831455 2:180241123-180241145 TACTTAAACCTATGGTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942831451 Original CRISPR GGTGTCATGAGATGAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr