ID: 942831532

View in Genome Browser
Species Human (GRCh38)
Location 2:180242181-180242203
Sequence CTAAAGAAACACATTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942831530_942831532 -10 Left 942831530 2:180242168-180242190 CCATTTAGCAGCACTAAAGAAAC No data
Right 942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG No data
942831529_942831532 0 Left 942831529 2:180242158-180242180 CCATTAGGGTCCATTTAGCAGCA No data
Right 942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG No data
942831526_942831532 25 Left 942831526 2:180242133-180242155 CCTCTAAGCAGGACTCGACTTGT No data
Right 942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942831532 Original CRISPR CTAAAGAAACACATTGAAGG TGG Intergenic
No off target data available for this crispr