ID: 942853865

View in Genome Browser
Species Human (GRCh38)
Location 2:180523054-180523076
Sequence CCTCCCTGACACAACACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942853862_942853865 11 Left 942853862 2:180523020-180523042 CCATCAACAGGAGTAATAGGCAG No data
Right 942853865 2:180523054-180523076 CCTCCCTGACACAACACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942853865 Original CRISPR CCTCCCTGACACAACACTAA TGG Intergenic
No off target data available for this crispr