ID: 942855527

View in Genome Browser
Species Human (GRCh38)
Location 2:180542064-180542086
Sequence ACTGAAGTTTAGAGCGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942855527_942855529 -5 Left 942855527 2:180542064-180542086 CCTGGACCGCTCTAAACTTCAGT No data
Right 942855529 2:180542082-180542104 TCAGTTTCCTCAGCTGTGAAAGG No data
942855527_942855530 -2 Left 942855527 2:180542064-180542086 CCTGGACCGCTCTAAACTTCAGT No data
Right 942855530 2:180542085-180542107 GTTTCCTCAGCTGTGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942855527 Original CRISPR ACTGAAGTTTAGAGCGGTCC AGG (reversed) Intergenic
No off target data available for this crispr