ID: 942856135

View in Genome Browser
Species Human (GRCh38)
Location 2:180551244-180551266
Sequence ATATAGAGAAAATACTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942856131_942856135 7 Left 942856131 2:180551214-180551236 CCCAAGCGTCTGCATTTTAAAGA No data
Right 942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG No data
942856132_942856135 6 Left 942856132 2:180551215-180551237 CCAAGCGTCTGCATTTTAAAGAA No data
Right 942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942856135 Original CRISPR ATATAGAGAAAATACTGGCA GGG Intergenic
No off target data available for this crispr