ID: 942865667

View in Genome Browser
Species Human (GRCh38)
Location 2:180671535-180671557
Sequence CTCCATTAGAAGGTGGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942865667_942865671 26 Left 942865667 2:180671535-180671557 CCTTAGCCCACCTTCTAATGGAG No data
Right 942865671 2:180671584-180671606 TTTCAGTTTCTTTTAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942865667 Original CRISPR CTCCATTAGAAGGTGGGCTA AGG (reversed) Intergenic
No off target data available for this crispr