ID: 942865671

View in Genome Browser
Species Human (GRCh38)
Location 2:180671584-180671606
Sequence TTTCAGTTTCTTTTAGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942865670_942865671 16 Left 942865670 2:180671545-180671567 CCTTCTAATGGAGTTATTTGTTT No data
Right 942865671 2:180671584-180671606 TTTCAGTTTCTTTTAGATTCTGG No data
942865669_942865671 19 Left 942865669 2:180671542-180671564 CCACCTTCTAATGGAGTTATTTG No data
Right 942865671 2:180671584-180671606 TTTCAGTTTCTTTTAGATTCTGG No data
942865667_942865671 26 Left 942865667 2:180671535-180671557 CCTTAGCCCACCTTCTAATGGAG No data
Right 942865671 2:180671584-180671606 TTTCAGTTTCTTTTAGATTCTGG No data
942865668_942865671 20 Left 942865668 2:180671541-180671563 CCCACCTTCTAATGGAGTTATTT No data
Right 942865671 2:180671584-180671606 TTTCAGTTTCTTTTAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942865671 Original CRISPR TTTCAGTTTCTTTTAGATTC TGG Intergenic
No off target data available for this crispr