ID: 942869998

View in Genome Browser
Species Human (GRCh38)
Location 2:180722957-180722979
Sequence TCCTTTTTAAGAAGCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942869998_942869999 4 Left 942869998 2:180722957-180722979 CCTGGACAGCTTCTTAAAAAGGA No data
Right 942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG No data
942869998_942870003 26 Left 942869998 2:180722957-180722979 CCTGGACAGCTTCTTAAAAAGGA No data
Right 942870003 2:180723006-180723028 GTATTCTGATTCATTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942869998 Original CRISPR TCCTTTTTAAGAAGCTGTCC AGG (reversed) Intergenic
No off target data available for this crispr