ID: 942869999

View in Genome Browser
Species Human (GRCh38)
Location 2:180722984-180723006
Sequence CTTCAACTCCAGCACTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942869998_942869999 4 Left 942869998 2:180722957-180722979 CCTGGACAGCTTCTTAAAAAGGA No data
Right 942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942869999 Original CRISPR CTTCAACTCCAGCACTGCCC AGG Intergenic
No off target data available for this crispr