ID: 942881789

View in Genome Browser
Species Human (GRCh38)
Location 2:180870616-180870638
Sequence GTGCCAGGTGGCTGCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881789_942881795 25 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881789_942881794 7 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881794 2:180870646-180870668 GAATCTGTGTACTAGAGAGAGGG No data
942881789_942881793 6 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881789_942881796 26 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881789 Original CRISPR GTGCCAGGTGGCTGCTACCA GGG (reversed) Intergenic
No off target data available for this crispr