ID: 942881790

View in Genome Browser
Species Human (GRCh38)
Location 2:180870617-180870639
Sequence TGTGCCAGGTGGCTGCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881790_942881794 6 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881794 2:180870646-180870668 GAATCTGTGTACTAGAGAGAGGG No data
942881790_942881796 25 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881790_942881795 24 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881790_942881793 5 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881790 Original CRISPR TGTGCCAGGTGGCTGCTACC AGG (reversed) Intergenic
No off target data available for this crispr