ID: 942881791

View in Genome Browser
Species Human (GRCh38)
Location 2:180870628-180870650
Sequence GATTCTCTCTTTGTGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881791_942881793 -6 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881791_942881794 -5 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881794 2:180870646-180870668 GAATCTGTGTACTAGAGAGAGGG No data
942881791_942881795 13 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881791_942881796 14 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881791 Original CRISPR GATTCTCTCTTTGTGCCAGG TGG (reversed) Intergenic
No off target data available for this crispr