ID: 942881792

View in Genome Browser
Species Human (GRCh38)
Location 2:180870631-180870653
Sequence ACAGATTCTCTCTTTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881792_942881796 11 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881792_942881795 10 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881792_942881793 -9 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881792_942881794 -8 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881794 2:180870646-180870668 GAATCTGTGTACTAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881792 Original CRISPR ACAGATTCTCTCTTTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr