ID: 942881793

View in Genome Browser
Species Human (GRCh38)
Location 2:180870645-180870667
Sequence AGAATCTGTGTACTAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881789_942881793 6 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881785_942881793 14 Left 942881785 2:180870608-180870630 CCCTCATCCCCTGGTAGCAGCCA No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881791_942881793 -6 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881792_942881793 -9 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881790_942881793 5 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881786_942881793 13 Left 942881786 2:180870609-180870631 CCTCATCCCCTGGTAGCAGCCAC No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881784_942881793 22 Left 942881784 2:180870600-180870622 CCACTCTTCCCTCATCCCCTGGT No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data
942881788_942881793 7 Left 942881788 2:180870615-180870637 CCCCTGGTAGCAGCCACCTGGCA No data
Right 942881793 2:180870645-180870667 AGAATCTGTGTACTAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881793 Original CRISPR AGAATCTGTGTACTAGAGAG AGG Intergenic
No off target data available for this crispr