ID: 942881795

View in Genome Browser
Species Human (GRCh38)
Location 2:180870664-180870686
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 7, 1: 40, 2: 114, 3: 208, 4: 607}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881791_942881795 13 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881788_942881795 26 Left 942881788 2:180870615-180870637 CCCCTGGTAGCAGCCACCTGGCA No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881789_942881795 25 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881792_942881795 10 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607
942881790_942881795 24 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG 0: 7
1: 40
2: 114
3: 208
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900715835 1:4142870-4142892 CAGGAAGAGTGAAGTGGCTGAGG + Intergenic
900772280 1:4554659-4554681 GAGGCAGAGGGCCGTGGCTGGGG + Intergenic
901230612 1:7639973-7639995 GAGGGAGAGGGCAGTGGCTGTGG + Intronic
901751446 1:11412459-11412481 GGGGGAGGGGGCAGTGAGTGTGG + Intergenic
901771169 1:11531064-11531086 GAGGGAGGATGGACTGACTGGGG + Intronic
901773443 1:11543065-11543087 CAGGCAGAGTGGAGTGACTGGGG - Intergenic
901984520 1:13063725-13063747 GAGGCCGAGTGCAGTGGCTCAGG + Intronic
901997290 1:13163045-13163067 GAGGCCGAGTGCAGTGGCTCAGG - Intergenic
902726479 1:18339380-18339402 GAGACAGAGTGCAGGGAGTGGGG + Intronic
903227967 1:21904530-21904552 GGAGGAGAGTGCAGGGACTCTGG - Intronic
903737153 1:25537312-25537334 CAGGCAGAGTGGTGTGACTGAGG - Intergenic
904128814 1:28260497-28260519 GAGGGAGAGCGCAGGGGCTCTGG + Intronic
904351513 1:29910056-29910078 GAGGGATAGAGCAGTGACGAGGG - Intergenic
904421686 1:30398354-30398376 GAAGGAGAGTGAAGTGACCTGGG + Intergenic
904633123 1:31858070-31858092 GTGGGAGAGTGAAGGGTCTGCGG + Intergenic
904820756 1:33242306-33242328 AAGGGACAGTACAGTGACCGTGG + Intergenic
905473030 1:38207336-38207358 CAGGGAGCGAGCAGTGCCTGAGG + Intergenic
905739815 1:40360691-40360713 GAAGGAGAGCACAGTGATTGTGG + Intronic
905740221 1:40363791-40363813 GAAGGAGAGTGCAGTGATTGTGG + Intronic
906315992 1:44786727-44786749 AAGGGAGAGTGGAGAGCCTGGGG + Intronic
906460359 1:46031550-46031572 GAGTGAGAGGGCTGTGGCTGAGG - Exonic
906686801 1:47768102-47768124 GAGGGATGGGGCAGTGAGTGAGG - Intronic
906790333 1:48653684-48653706 GAGGGAGAGAGCATTTCCTGCGG + Intronic
906827173 1:48993805-48993827 GAGGGAGAGTGCAGTGATTGTGG - Intronic
907115377 1:51963597-51963619 GTGGGAGAGTGAATAGACTGTGG - Intronic
907386366 1:54128119-54128141 AAGGGAGAGTGCAGAACCTGGGG - Intergenic
907388241 1:54139677-54139699 GAAGGAGACTGCAAAGACTGAGG + Exonic
908093019 1:60706647-60706669 GAGGGAAAGTGAAGTGACTGTGG + Intergenic
908363274 1:63390801-63390823 GAGGGAGAGTGCAGTGACTATGG - Intronic
908385695 1:63639420-63639442 GAAGGAGAGCGCAGAGAGTGAGG - Intronic
908397694 1:63741213-63741235 GAGGGAGAGCACAGTGATTGTGG - Intergenic
908420305 1:63952611-63952633 GAGGGAGAGTGCTGGGGATGAGG + Intronic
908788920 1:67761793-67761815 GAGGGAGGGTGCAGGGAGAGAGG + Intronic
909582461 1:77253466-77253488 GAGGGAGAGTGAAGTGATTGTGG + Intergenic
909848911 1:80434819-80434841 GAGGGAGATCTCAGTGACTGGGG - Intergenic
910070996 1:83213379-83213401 GAGGGAATGAGCAGTGGCTGAGG + Intergenic
910354448 1:86339891-86339913 GTAGGTGAGAGCAGTGACTGAGG - Intergenic
910422436 1:87080767-87080789 GGGGGAGAGCACAGTGATTGCGG + Intronic
910470526 1:87547746-87547768 GAGGGAGAGGACAGTGACTGTGG - Intergenic
910716509 1:90236756-90236778 GAGAGAGAGTGCAGTGGCTGGGG - Intergenic
910724844 1:90327792-90327814 GAGGGAGAATGCAGTGATTGTGG + Intergenic
910885501 1:91959282-91959304 GAGGGAGGTTACAGTGACAGGGG + Intronic
911011607 1:93287183-93287205 GAAGGAGAATGCAGTGATTCTGG + Intergenic
911187287 1:94916395-94916417 GAGGGGGATTGCAGGGAGTGGGG + Intronic
911344101 1:96675128-96675150 GAGGGAGAGCACAGTGATTGTGG - Intergenic
911594280 1:99782803-99782825 GATGGAGAGTGCACAGAATGTGG - Intergenic
911742348 1:101400808-101400830 GAGGGAGAGAGCAGTCCCAGAGG + Intergenic
911942860 1:104069514-104069536 AAGAGAGAGTGCAATGACTGGGG - Intergenic
912015238 1:105026687-105026709 GAAGGAGAGCCTAGTGACTGTGG + Intergenic
912018549 1:105072981-105073003 AAGGAAGAGTGCAGTGACTGAGG - Intergenic
912152643 1:106879442-106879464 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
912316310 1:108670253-108670275 GTGGGAGAGCACAGTGACTGGGG + Intergenic
912643820 1:111372274-111372296 AAGGGAGAGCACAGTGATTGTGG + Intergenic
912871406 1:113310479-113310501 GAGGGAGAGCACAGGGATTGTGG + Intergenic
912873242 1:113328864-113328886 GAGGGAGAATGCAGTAATTGTGG - Intergenic
915005228 1:152629470-152629492 GAAAGAGAGTGCAGTGATTGTGG + Intergenic
915011211 1:152687798-152687820 GAGAAGGAGTTCAGTGACTGTGG - Intergenic
915185826 1:154104562-154104584 CTGGGGGAGTGCAGTGATTGTGG - Intronic
915656221 1:157363229-157363251 GAGGGAGAGTGCAGGGGTAGGGG - Intergenic
915673059 1:157506348-157506370 GAGGGAGAGTGCAGGGGTAGGGG + Intergenic
915693758 1:157717118-157717140 GAGGGAAAGCACAGTGACTAGGG - Intergenic
915752661 1:158226760-158226782 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
917169556 1:172155912-172155934 GCAGTAGAGTGCAGTGACTGAGG + Intronic
917306126 1:173627466-173627488 GAGGGAGAGCACAGTGACTGTGG + Intronic
917397038 1:174604347-174604369 GAGGGAGAGGACAGTGATTGTGG - Intronic
917405040 1:174696679-174696701 AAGGGAGAGAGCAGGGATTGTGG - Intronic
917600501 1:176569270-176569292 CAGGGAGAGTGCTGTATCTGTGG - Intronic
917916667 1:179709090-179709112 GTGGGGGAGTGCAGTGAATAAGG - Intergenic
918357891 1:183723504-183723526 GAGGGAGAGTACAGTGACTGTGG + Intronic
918389358 1:184041734-184041756 GAGAAAAAGAGCAGTGACTGAGG + Intergenic
918892708 1:190295754-190295776 GAGGGAAAGGGAAGTGAGTGTGG - Intronic
918959561 1:191255901-191255923 GAGGGAGAGAAAAGTGAGTGTGG - Intergenic
919047385 1:192470422-192470444 GAGGGAAAGTGAAGTGATTGTGG - Intergenic
919067664 1:192713885-192713907 GAGGGAGAATGCATTGAGTGTGG + Intergenic
919147337 1:193651936-193651958 AAGGGAGAGCACAGTAACTGTGG - Intergenic
919169704 1:193938552-193938574 GGGGGAGAGTGCAGCAATTGTGG + Intergenic
920396200 1:205647919-205647941 GAAGGAGAGTGCATTAACTAGGG + Intergenic
920596828 1:207280193-207280215 GAGGGAGAGCACAGTTACTGTGG - Intergenic
920793412 1:209114535-209114557 CAGGGAGGGTGCAGTGAAGGAGG - Intergenic
920849760 1:209620856-209620878 GAGGGAGAGTGGAAAGTCTGTGG - Intronic
921678671 1:218006238-218006260 AAGGAAGAGTAGAGTGACTGAGG - Intergenic
921746122 1:218742678-218742700 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
921935885 1:220796656-220796678 GAGATAGAGGGCAGGGACTGTGG + Exonic
922044187 1:221927878-221927900 GAGAGAGAATGCAGTGATTATGG + Intergenic
922377031 1:224979325-224979347 GAGGGAGAGTGCAGTGCTTGTGG + Intronic
922388660 1:225114777-225114799 GAGAGAGAGCACAGTGACTGTGG - Intronic
924004979 1:239599282-239599304 GAGGGAGAGCGTTGTCACTGTGG - Intronic
924459637 1:244247618-244247640 GAGAGGGAGAGCAGAGACTGGGG + Intergenic
924490927 1:244536563-244536585 GAGACAGAGTGCAGTGATTGTGG - Intronic
924516320 1:244769012-244769034 GAGGGAGAGCGCAGTGACTGGGG - Intergenic
1063948850 10:11203975-11203997 GAGGCTGAGTGGAGAGACTGGGG + Intronic
1064418126 10:15168314-15168336 GCGGGAGAGTGCAGTGCGCGGGG - Intronic
1064521725 10:16209893-16209915 GAGGAAGAGCACAGTGACTGGGG - Intergenic
1064973404 10:21089030-21089052 GAGAGATGGTGCAGTGACAGAGG + Intronic
1064987631 10:21226676-21226698 GAGGGAGAGTAAAGTGATTGTGG - Intergenic
1065105703 10:22381631-22381653 GAGAGAGGTTGCAGTCACTGGGG + Intronic
1065431560 10:25662056-25662078 GAAGGAGAGTGTAGTGACTGTGG - Intergenic
1065921715 10:30398958-30398980 AAGGGAGAGTGCAGCAATTGTGG + Intergenic
1066046215 10:31597793-31597815 AAGTGACATTGCAGTGACTGAGG + Intergenic
1066287464 10:33982193-33982215 GAGGGGGAGTGCAGGAGCTGGGG + Intergenic
1066395608 10:35018390-35018412 GAGGGAAAATGCAGTCTCTGGGG - Intronic
1066649839 10:37643671-37643693 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1066653151 10:37678667-37678689 GGAGGAGAGAGGAGTGACTGAGG - Intergenic
1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG + Intergenic
1067032729 10:42889218-42889240 GAAGGAGAGTGCAGTGATTATGG - Intergenic
1067202349 10:44184485-44184507 GTGGGAACGTGCAGTGACAGGGG - Intergenic
1067706336 10:48609189-48609211 CAGGGAGTCTACAGTGACTGGGG - Intronic
1067842457 10:49691822-49691844 GAGTGAGGGTGCATGGACTGTGG - Intronic
1068124900 10:52827523-52827545 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
1069050570 10:63788304-63788326 GAGGGAGAGCACAGTGACTGGGG + Intergenic
1069193571 10:65520303-65520325 GAGGGAGAGAGCAGTGATAGTGG - Intergenic
1070059557 10:72968676-72968698 GAGGGAAAGTACAGTAACTGGGG - Intergenic
1070435033 10:76383015-76383037 AATGGTTAGTGCAGTGACTGTGG - Intronic
1070464133 10:76702877-76702899 GAAGGAGAGTGCAGTGATCATGG + Intergenic
1071586949 10:86832572-86832594 GAGGTAGAAGGCAGTGATTGTGG - Intronic
1071684436 10:87739774-87739796 GATGAATAGTGCAGTGACTATGG - Intronic
1071757149 10:88555815-88555837 GAGGGAGATGCCAGTGAGTGAGG - Intronic
1072492501 10:95921318-95921340 GAGGGAGAGTTAAGTGATTGGGG - Intronic
1073827213 10:107337479-107337501 GAGGGAGATCACAGTGACTGGGG - Intergenic
1074302282 10:112243240-112243262 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1074601974 10:114923742-114923764 GAAGGACAGTTCAATGACTGTGG + Intergenic
1074670050 10:115780153-115780175 GAGGGAGAGCACAGTGATTGTGG + Intronic
1075496260 10:122922165-122922187 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1075688195 10:124378358-124378380 GAGGGAGAATGCAGTGAGGAGGG + Intergenic
1076183701 10:128430637-128430659 GAGAGAGAGAGCAGGGACAGAGG - Intergenic
1076184813 10:128438064-128438086 GAGGAAGGGTGACGTGACTGTGG - Intergenic
1076474464 10:130742772-130742794 GAGGGAGATTGCAGATCCTGTGG + Intergenic
1076760808 10:132605108-132605130 GAGGGAGTGGGAAGGGACTGGGG + Intronic
1077427330 11:2489241-2489263 GAGGGAAAGTGCAGTGCTTTGGG + Intronic
1077571554 11:3343091-3343113 GAGGGAGAGTTCACTTTCTGGGG + Intronic
1077858764 11:6156803-6156825 GAGGAAGAGCGCAGCGATTGTGG + Intergenic
1078690782 11:13578734-13578756 GAGGGAGAGTGCAGGGATTGCGG + Intergenic
1079416300 11:20239183-20239205 GAAGGAGAGCACAGTGACTGGGG - Intergenic
1079443281 11:20536260-20536282 CAGCCAGAGTGCCGTGACTGTGG - Intergenic
1080096878 11:28418774-28418796 CAGGCAAAGTGCAGTGAATGTGG + Intergenic
1080966641 11:37220568-37220590 GAGAGAGAATGCAGTGATCGTGG - Intergenic
1081162132 11:39761917-39761939 AAGGGAAAGAGCAGTCACTGGGG + Intergenic
1081212707 11:40355624-40355646 GAGGGACAGTGCATTGTGTGTGG - Intronic
1081868451 11:46372345-46372367 GAGGGAGAGGGGTGTGACTGTGG - Intronic
1082012527 11:47459800-47459822 GAGGACGAATGCAGTGGCTGTGG + Intergenic
1083269752 11:61565888-61565910 TAGGGAGAGTGCGCTGGCTGGGG + Intronic
1084148345 11:67276690-67276712 GAGAGGGAGAGGAGTGACTGCGG - Intronic
1084153290 11:67301178-67301200 GAGGGAGGGTGCCATGCCTGAGG - Intronic
1084156743 11:67317460-67317482 GAGGGAGGGGGCTGTGACGGTGG - Intergenic
1084168014 11:67385778-67385800 GAGGGAGAGAGGAGTGTCAGGGG - Intronic
1084537967 11:69768931-69768953 GAGGGAGATGACAGTGAATGAGG - Intergenic
1084616029 11:70236532-70236554 TAGGCAGAGGGCAGTGAATGGGG + Intergenic
1084692199 11:70734021-70734043 GGGAGGGTGTGCAGTGACTGGGG + Intronic
1084763961 11:71295402-71295424 GAGGTATAATGCAGTGATTGTGG - Intergenic
1085194852 11:74662958-74662980 GAGGGAGAGTGCAGCAACTGTGG - Intronic
1085372404 11:76021023-76021045 GAGGGAGAGCACAGCGATTGTGG - Intronic
1085391679 11:76185385-76185407 GAGGGACAGTGATGTGCCTGCGG + Intergenic
1085473288 11:76771767-76771789 GAGGGAGAATGCTTTGACTAAGG - Intergenic
1085562662 11:77486631-77486653 GAGGGAAAGCACAGTGATTGTGG + Intergenic
1085572245 11:77569532-77569554 GAGGGAGAGTGCAGTGATTATGG - Intronic
1086032989 11:82383212-82383234 GAGGGAGAGCACAGCAACTGAGG + Intergenic
1087566811 11:99870318-99870340 GTGGAAGAGTGAAGTGACAGTGG - Intronic
1087874550 11:103339968-103339990 GAGCAAGAGTGAAGTGAGTGTGG - Intronic
1088009721 11:104985678-104985700 GAGGGAGAGTACAGCATCTGAGG + Intergenic
1088135921 11:106555114-106555136 GAAGGAGAGCACAGTGACTAGGG - Intergenic
1088181705 11:107120756-107120778 GATGAAGAGAGCAGTGATTGTGG + Intergenic
1088330637 11:108647590-108647612 GAGGGAGAGCAAAGTGAGTGTGG + Intergenic
1088889590 11:114033968-114033990 GAGGGAGGGTGCAGGGCCTGGGG + Intergenic
1088944583 11:114496314-114496336 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1089013263 11:115147394-115147416 GGGGGAGAGTGGAGTGTGTGTGG + Intergenic
1089396121 11:118137126-118137148 GAGGGAGAGAGAAGGGACAGTGG + Intronic
1089844850 11:121450820-121450842 GTGGGAGAGTGCAGAACCTGAGG + Intergenic
1090210493 11:124917567-124917589 GAGGGAGAGTGCAGTCATTGTGG - Intergenic
1090439440 11:126713710-126713732 GAGGGAGAGTGGAGGGTGTGGGG + Intronic
1091275963 11:134350426-134350448 AAGGGAGAGCACAGTGACTGGGG - Intronic
1092232212 12:6782533-6782555 GAGGGAGACAGGAGTCACTGGGG + Intergenic
1092477142 12:8828951-8828973 GCGGGAGAGCACAGTGACTGTGG - Intronic
1092497511 12:9011814-9011836 GAGGAAGAGTGCTGTGATTATGG + Intergenic
1093321383 12:17719090-17719112 GAGAGAGAGCCCAGTGACTGTGG - Intergenic
1093531901 12:20175253-20175275 GAGAGAGAGTCCAGTGACTGTGG - Intergenic
1093931625 12:24960328-24960350 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1094655924 12:32419458-32419480 GAGGGAGAATGCAGTGACTGGGG - Intronic
1095163212 12:38941087-38941109 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1095860140 12:46907801-46907823 AAGGGAGAGTGCAGTGACTGTGG + Intergenic
1096539955 12:52301555-52301577 GAAGGAGTGGGCAGTGACTCAGG - Intronic
1096548947 12:52359731-52359753 GAGGGTGAGAGCAGTGAGTTTGG + Intergenic
1097030011 12:56083238-56083260 GAGGGTGGGGGCAGTGCCTGGGG - Intronic
1097569095 12:61308722-61308744 GTGGGAGAGCGCAGTGACTGAGG - Intergenic
1097714860 12:62955207-62955229 GATGTAGAGTGCAGTGACTAAGG - Intergenic
1098959030 12:76719137-76719159 GAGGGAGAGGAGAGTGAGTGTGG + Intergenic
1099101012 12:78440095-78440117 GAGGGAGAGCAAAGTGACTGTGG - Intergenic
1099119113 12:78665606-78665628 GAGGGAGAGTGCAGCAACCGGGG - Intergenic
1099491304 12:83292059-83292081 AAGGGAGAGTGTAGTGATTGTGG + Intergenic
1099523348 12:83690379-83690401 GAAAGATGGTGCAGTGACTGTGG - Intergenic
1099757786 12:86876892-86876914 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1100904807 12:99285755-99285777 GAGGAAGAGAGCAGTAATTGTGG + Intronic
1100946300 12:99787818-99787840 AAGGGAGAAAGCAGTGACTGAGG + Intronic
1101506534 12:105351960-105351982 GAGGGAGGGTGCAGGCACAGAGG + Intronic
1101523040 12:105502646-105502668 GGGGGAGAGTGCAGAGGGTGAGG + Intergenic
1101667919 12:106836985-106837007 GAGAGAGAGTAATGTGACTGAGG - Intronic
1102266513 12:111490809-111490831 GAGAGAGAGAGAAATGACTGTGG + Intronic
1103393008 12:120587767-120587789 GAGGGAGAGAGCACTCTCTGGGG - Intergenic
1103817404 12:123669801-123669823 GACTGAGAGTGCAGGGTCTGAGG - Intergenic
1105796673 13:23860944-23860966 AGGGGAGTGTGCAGTGCCTGGGG + Intronic
1106298262 13:28438437-28438459 AAGGGAGAATGACGTGACTGTGG - Intronic
1106350214 13:28922632-28922654 GAGGGAGAGCGCAATGACTGGGG - Intronic
1106519862 13:30487112-30487134 GTGTGAGAATGCAGTGAATGTGG + Intronic
1106601898 13:31195346-31195368 GACCGAGAGTTCAGAGACTGAGG - Intergenic
1106956284 13:34942502-34942524 GAGGGAGAGAGCAGAGGCAGCGG + Exonic
1107753948 13:43599325-43599347 GAGGGAGAGTGCAGCGATGGTGG - Intronic
1107753959 13:43599366-43599388 AAGGGAGAGTGCAGTGATAGTGG + Intronic
1107808347 13:44175548-44175570 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1107967961 13:45614517-45614539 GAGGGAAAGTGAAGTGATGGGGG - Intronic
1108272471 13:48774905-48774927 GAGAGAGAGAGCAGTGGATGAGG - Intergenic
1108503740 13:51090910-51090932 GACAGAGAGTTCAGTGGCTGAGG - Intergenic
1108816697 13:54301390-54301412 GAAGGAGAGGGAAGTGAATGTGG - Intergenic
1108879152 13:55087630-55087652 GAGAGAGAGCACAGTTACTGTGG - Intergenic
1108887011 13:55199364-55199386 TAGGGAGAGTGCATCCACTGGGG - Intergenic
1109211363 13:59538963-59538985 GAGGGAAAGCGCAGTGACTGGGG - Intergenic
1109566902 13:64130420-64130442 GAAGGAGAATGCAGCAACTGGGG + Intergenic
1109926440 13:69146763-69146785 GAGGGAGAGTGAAGTTGTTGTGG + Intergenic
1109961761 13:69640025-69640047 GAGGGAGAGCACAATGATTGCGG - Intergenic
1110079047 13:71287474-71287496 GAGAGAAAGCGCAGTGACTGTGG - Intergenic
1110448877 13:75618613-75618635 GAGGGAGAGTAGAGTGATTATGG - Intergenic
1110557211 13:76873609-76873631 GAGGAAGAATGGAGTTACTGAGG - Intergenic
1110665875 13:78116771-78116793 GAGGGAGAATGCAGTGACTGTGG - Intergenic
1111077008 13:83249610-83249632 TCGGGGGAGTGCAGTGATTGTGG - Intergenic
1111255637 13:85663763-85663785 AAGAGAGATTGCAGTGACGGGGG - Intergenic
1111335458 13:86815764-86815786 AAGGGAGAGTGCTGTGATTGTGG + Intergenic
1111583451 13:90253743-90253765 CAGGGAGAGTGAAGTGAGTGTGG - Intergenic
1111639192 13:90946624-90946646 GAGGGAGAGCATAGTGATTGTGG + Intergenic
1112944500 13:104910749-104910771 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1113244429 13:108378254-108378276 AAGGGATAGCACAGTGACTGTGG - Intergenic
1113263813 13:108594320-108594342 GAGGGAGAATGCAGGCAGTGAGG - Intergenic
1113523948 13:110959281-110959303 GAGAGAGAAAGCAGTGCCTGTGG - Intergenic
1113834288 13:113318745-113318767 GAGGGAGAAGGCAGTGAGTGTGG - Intronic
1114250797 14:20958801-20958823 GAGGGACAGTGCAGCAATTGTGG + Intergenic
1115133882 14:30086205-30086227 GAGGGAGAGCACAGTGACTGGGG + Intronic
1115485965 14:33911593-33911615 GAGAGAGAGTCCAGTGGCAGTGG - Intergenic
1115925255 14:38425805-38425827 GAGGAAGAGCACAGTGATTGTGG - Intergenic
1116114875 14:40635388-40635410 GAGAGAGAATGTAGTGATTGTGG + Intergenic
1116275724 14:42828431-42828453 GAGGGAGACCACAGTGATTGTGG - Intergenic
1116413090 14:44648979-44649001 AAGGGAGAGTTCAGTGATTATGG + Intergenic
1116888950 14:50249000-50249022 AAGGGAGGGTACAGTGGCTGGGG + Intronic
1117161618 14:52995342-52995364 GAGGGAGAGCACAGTGACTATGG - Intergenic
1117208573 14:53470824-53470846 GAGAGAGAGCACAGTGATTGTGG - Intergenic
1117233874 14:53751575-53751597 GACGGATGGTGCAGTGACTGGGG + Intergenic
1117446073 14:55804966-55804988 GAGGGAGAGCTCAGTGTCAGTGG + Intergenic
1117646741 14:57861115-57861137 TAGGGAGAGTGAATGGACTGGGG - Intronic
1117795547 14:59389371-59389393 GAGAAAGAGTGCAGTGGTTGTGG - Intergenic
1118034283 14:61849624-61849646 GAGGGAGAGCATAGTGATTGTGG - Intergenic
1118241277 14:64060930-64060952 GAGGGAAAGCGCAGCAACTGGGG - Intronic
1118431285 14:65720950-65720972 GAGGGGGAGCACAGTGATTGTGG - Intronic
1118578626 14:67270609-67270631 GAGGGAGAGTGCAATTGCTTTGG + Intronic
1118632831 14:67722108-67722130 GGAGGAGGGGGCAGTGACTGGGG - Intronic
1118747996 14:68787543-68787565 GAGAGAGAGGGCTGTGGCTGTGG - Intergenic
1118959285 14:70514086-70514108 CAGGAAGAATGCAGAGACTGGGG - Intergenic
1120107859 14:80516745-80516767 GAGAGAGAGAACAGTGATTGTGG - Intronic
1121472500 14:94166167-94166189 GAGGGAGAGGGCAGTGAGATGGG - Intronic
1121540010 14:94718527-94718549 GAGGTGGAGTGCATTGCCTGAGG + Intergenic
1121959566 14:98246913-98246935 GAAGGAGAGTGGACTGAATGAGG - Intergenic
1122112946 14:99514553-99514575 GGGGGACATTGCAGAGACTGGGG + Exonic
1122151593 14:99728846-99728868 GAGGCAGAGGGCATGGACTGTGG - Intergenic
1123164661 14:106314887-106314909 CAGGCAGAGGGCAGTGTCTGAGG + Intergenic
1123452709 15:20381080-20381102 GAGTGTGAGTGGTGTGACTGTGG + Intergenic
1124142889 15:27093015-27093037 GGGGTAGGGTTCAGTGACTGGGG - Intronic
1125501341 15:40241753-40241775 CAGGGAGGGTGCAGTGGGTGGGG + Intronic
1125585428 15:40816022-40816044 GCGGGAAAGTGCTGTGACTTGGG - Intronic
1126452454 15:48823567-48823589 GAGGGAGAATGCAGTGCCTTGGG - Intergenic
1126489146 15:49216809-49216831 GAGGGAGGGTGAAGTGAGTGTGG - Intronic
1126660830 15:51031471-51031493 GAGAGGGACTGCAGTGATTGTGG - Intergenic
1126706748 15:51413489-51413511 GAGGGAGAGGACAGTAATTGTGG + Intergenic
1127155878 15:56123856-56123878 GAGAGAGAGTGCAGCAGCTGTGG - Intronic
1127493202 15:59484557-59484579 GAGGGAGAGTGCAGTGTTTATGG + Intronic
1127935481 15:63632998-63633020 GAGGGAGTGTGCAGGGGCAGAGG + Intronic
1127971647 15:63966734-63966756 GAGGGAGAGTGCAGCAATTGTGG - Intronic
1128496619 15:68201858-68201880 GAGGGAGAGTGAAGAGATGGTGG - Intronic
1129030752 15:72616018-72616040 GAGGGAGAATGCAGCAACTGTGG - Intergenic
1129356411 15:74995155-74995177 GCAGGAGAGTGTGGTGACTGCGG - Intronic
1129477595 15:75796542-75796564 GAGGGAGAATACAGCAACTGTGG - Intergenic
1129686927 15:77691562-77691584 GAGGGAGGGTCCAGTGGCAGTGG - Intronic
1129703755 15:77782948-77782970 GAGGGAGAGAGCGGGGACAGGGG - Intronic
1129731657 15:77935830-77935852 GAGGCCGAGTGCAGTGGCTCGGG + Intergenic
1129835662 15:78703819-78703841 GAGGGAGAATGCAGCAACTGTGG - Intronic
1130351755 15:83098897-83098919 GAGGAAGTGTGCAGTTACAGTGG - Intergenic
1130441260 15:83956218-83956240 GAGGGAGAGCACAGCAACTGGGG - Intronic
1130511673 15:84594817-84594839 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1131944799 15:97608396-97608418 GAAGGAAAGTGCAGTGATTGTGG + Intergenic
1132404841 15:101535989-101536011 GAGAGATAGGGCAGTAACTGGGG + Intergenic
1133308266 16:4825304-4825326 GAGCTAGAGAGCAGTGACGGGGG - Intronic
1133834305 16:9352329-9352351 AAGACAGAGTGCAGTGATTGTGG - Intergenic
1135220212 16:20608169-20608191 GAGGGAGAGTTCACTTTCTGTGG - Intergenic
1135418346 16:22286811-22286833 AAGGGTGAGTGCACTGACTAGGG - Exonic
1136676616 16:31914176-31914198 GACGGAGAGCACAGTGACTAGGG - Intronic
1136679123 16:31945056-31945078 GAGGGAGATTGCAGCAACTGGGG + Intergenic
1136922411 16:34343975-34343997 GAGGGAGTGTGCAGTGGTGGGGG - Intergenic
1136982162 16:35067831-35067853 GAGGGAGTGTGCAGTGGTGGGGG + Intergenic
1137554749 16:49463470-49463492 GGGGGAGAGTGCAGAGCATGTGG + Intergenic
1137616371 16:49850203-49850225 GAGGCAGGGTGAAGTGAGTGAGG - Intronic
1138806934 16:60100907-60100929 GAGAGCGAGCACAGTGACTGTGG - Intergenic
1138845059 16:60554981-60555003 GAGGGAGAGTGCAGTGATAGGGG - Intergenic
1138890837 16:61142467-61142489 GAGGGAGAGTGCAGAGATTGTGG - Intergenic
1139005042 16:62559488-62559510 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
1139786671 16:69398505-69398527 TAGGGAGAGAGCAGGGACTCTGG + Intronic
1140306714 16:73809574-73809596 CAGTGAAAGTGCATTGACTGGGG + Intergenic
1140317273 16:73911307-73911329 CAGGTAGAGTGCAGTCAATGTGG + Intergenic
1140861265 16:79020254-79020276 GATGGAGAGGACAGTGCCTGGGG + Intronic
1141485007 16:84333166-84333188 GAGGAAGACTGCAGCCACTGGGG + Intergenic
1142919138 17:3169344-3169366 GAGAGAGAATGCAGTGAGTGTGG + Intergenic
1143413584 17:6728428-6728450 GAGGGAGAGTAGAGTGATTGTGG + Intergenic
1143710299 17:8729884-8729906 GGGGAAGAGTGCAGTGACGGGGG - Intergenic
1143714628 17:8758116-8758138 GAAGGAGGGTGCAGGGAATGGGG - Intronic
1144404473 17:14939501-14939523 GAGGGAGAGGGGAGCGACGGAGG + Intergenic
1144564589 17:16349496-16349518 GAGCGAGAGTGGAGGGCCTGGGG + Intronic
1144663603 17:17087335-17087357 GAGGGAGAGGGAAGTGTGTGGGG + Intronic
1144721141 17:17470656-17470678 GTGGGAGGGAGAAGTGACTGAGG + Intergenic
1144859537 17:18292228-18292250 GTGGGAAACTGCAGTGACAGGGG + Intronic
1144946424 17:18971753-18971775 GAGAGAGAGAGCAGAGAGTGAGG + Intronic
1145069084 17:19787909-19787931 GAGGGAGAGTGCAGCAATTTGGG + Intronic
1145201017 17:20944752-20944774 CAGGGAGAGCTCAGTGATTGTGG - Intergenic
1145272336 17:21411404-21411426 GAGGGAGAGAGCAGGCAGTGGGG - Intronic
1145310542 17:21698869-21698891 GAGGGAGAGAGCAGGCAGTGGGG - Intronic
1145929413 17:28674378-28674400 GAGGATGAGGGCAGTGACTCTGG + Exonic
1145943623 17:28757676-28757698 AAGGGCAAGTGCAGTGGCTGTGG + Exonic
1146098966 17:29960134-29960156 CAGGGAGAGCACAGTGACTGTGG - Intronic
1147456969 17:40543864-40543886 AAGGAAGAGTGAAGTGACTTGGG - Intergenic
1147661232 17:42118145-42118167 GAGAGAGAAGGCAGGGACTGGGG + Intronic
1148029291 17:44608628-44608650 GGGGGGCAGTGGAGTGACTGGGG + Intergenic
1148124851 17:45231315-45231337 GAGGGAGGCTGCAGAGGCTGGGG + Intronic
1148858890 17:50593801-50593823 ATGGGAGTGGGCAGTGACTGTGG + Intronic
1149188435 17:54029952-54029974 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1149249346 17:54750034-54750056 ATGGGAGAGTGCAGTGATTGTGG - Intergenic
1149278342 17:55071284-55071306 GAGGTAGAGTGAAGTGGCAGAGG - Intronic
1149351580 17:55793388-55793410 GAGTGAGAGTGCAGAGAATTCGG - Intronic
1150336975 17:64337439-64337461 CAGGGATAATACAGTGACTGTGG + Intronic
1150531768 17:65990885-65990907 GAGGAGGAGAGCAGCGACTGGGG + Intronic
1150870896 17:68910320-68910342 GAGGGAGAGGACAGTCATTGTGG + Intronic
1152070284 17:78130871-78130893 GAGGGAGAATGCAGAGGGTGAGG + Intronic
1152312323 17:79558774-79558796 GAGGGAGAGAGGAGGGACCGAGG + Intergenic
1152660680 17:81540527-81540549 GAAGGCGAGTGCAGGGGCTGCGG + Exonic
1152891970 17:82887300-82887322 GAGGGAAACAGCAGGGACTGTGG - Intronic
1203162234 17_GL000205v2_random:63094-63116 GAGGGAAAGTGCAGCACCTGTGG - Intergenic
1153356708 18:4144414-4144436 GAGGGAGAACACAGTGATTGTGG - Intronic
1153429353 18:4999139-4999161 GAGGGAGAGTGCAGTGACTGAGG + Intergenic
1153765369 18:8369555-8369577 CAGGAAGAGCGCAGTGACTGTGG + Intronic
1154085984 18:11305890-11305912 GAGGGAGAGCACAGCAACTGGGG - Intergenic
1155443291 18:25884415-25884437 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1155767348 18:29652368-29652390 GAGGGAGAATGCAGTGAATGTGG + Intergenic
1155792756 18:29995470-29995492 GAGGGAGCGCATAGTGACTGTGG + Intergenic
1155922792 18:31619952-31619974 GAGAGAGAGAGCAGGGACTCCGG + Intergenic
1156045220 18:32870457-32870479 CAGGTACAGTGCAGTGACTTAGG - Intergenic
1156274414 18:35569505-35569527 GATGGAGAATTCAGTGACTCTGG - Intergenic
1157168626 18:45381840-45381862 GAGCGAGAGTCCAGTGGCAGCGG + Intronic
1157285550 18:46374924-46374946 GTAGGGAAGTGCAGTGACTGGGG - Intronic
1157564031 18:48667829-48667851 GAGTCTGAGTGCAGTGTCTGTGG + Intronic
1157879196 18:51304112-51304134 GAAGGAGAGTGCAGTGATTGTGG + Intergenic
1158035251 18:53020851-53020873 AAGAGAGAGTGCAGAGCCTGCGG + Intronic
1158225112 18:55192744-55192766 GAAGGAGATTAAAGTGACTGAGG + Intergenic
1158430629 18:57383176-57383198 GAGGAATAGTGCAGTGGCCGGGG - Intergenic
1158915513 18:62122996-62123018 GAGGCTGGGTGCAGTGACTCAGG + Intronic
1159080517 18:63730757-63730779 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
1159446199 18:68544531-68544553 TCAGGAGAGTGCAGTGATTGTGG + Intergenic
1159564855 18:70036978-70037000 GAGGGAGAGAGCAGCGACTGGGG + Intronic
1159826094 18:73212655-73212677 GAGAGAGAGTGACGTAACTGAGG + Intronic
1160597010 18:79982719-79982741 GAGAGAGAGGGAAGTTACTGTGG + Intronic
1161021013 19:2011509-2011531 GATGGAGAGTGCAGTGCCCCAGG - Intronic
1161274072 19:3405448-3405470 GAGGGAGAGTGCTTTTAGTGAGG + Intronic
1161283904 19:3459233-3459255 GGGGGAGAGTCCATGGACTGGGG - Intronic
1161291680 19:3497067-3497089 GAGAGGCAGTGCAGAGACTGAGG - Intronic
1161469020 19:4447211-4447233 GGGGGAAAGGGCAGGGACTGGGG - Intronic
1162186411 19:8908612-8908634 GAGGGAGAATGGAGTCCCTGAGG + Exonic
1162596030 19:11629986-11630008 GAGGGAGAGCGCAGTGATTGTGG + Intergenic
1163480099 19:17550191-17550213 AAGGGAGATTGTAGTGACAGGGG + Intronic
1163581987 19:18144658-18144680 GAGGGACAGGGCAGAGACAGAGG - Exonic
1163600743 19:18247816-18247838 AAGGGAGGGTGCAGAGAGTGTGG - Intronic
1163860266 19:19739087-19739109 TATGGAGAGGGCAGAGACTGAGG + Intergenic
1165279762 19:34785987-34786009 GAGTGAGGGTGCAGTGGCTCTGG + Intergenic
1166301564 19:41914378-41914400 GAGGGAGAGGGCAGTGAGGTGGG - Intronic
1166676753 19:44745799-44745821 GAGGGAGAGGGCACAGTCTGAGG - Intergenic
1166746249 19:45143220-45143242 GAGGGAGACAGTGGTGACTGTGG + Intronic
1167397038 19:49236608-49236630 TAGGGTGAGTGCAATGAGTGAGG - Intergenic
1167793470 19:51694447-51694469 GAGGGAGGGAGCAGGGGCTGGGG - Intergenic
1168275699 19:55277168-55277190 GAGGCAGAGTAGAGTGAGTGAGG - Intronic
1168595046 19:57668641-57668663 GAGGGAGAGTGCAGGGAAGAAGG + Intergenic
925115314 2:1373745-1373767 CAGGGAGAGCGGAGAGACTGTGG - Intergenic
925146862 2:1587868-1587890 GAGGGACAGAGCAGGGACAGAGG - Intergenic
925306009 2:2848832-2848854 GAGGGAGAGGGGAGGGCCTGGGG + Intergenic
925588469 2:5486941-5486963 GAGAGAGAGTGCAGTGATTATGG + Intergenic
925699060 2:6614371-6614393 GACGGAGAGTGCTGTGAGTGTGG - Intergenic
926346710 2:11953677-11953699 GAGGGAGAGTGCAGTCCCATAGG + Intergenic
926368521 2:12156220-12156242 GATGGAGAGTGCAGTGAGACAGG + Intergenic
926518749 2:13883411-13883433 GAGGGAGAGCACAGTGATTGCGG + Intergenic
926803928 2:16687088-16687110 GAGGCCGTGTGCATTGACTGAGG - Intergenic
927370189 2:22345519-22345541 GAGGGAGAATGTAGTGATAGAGG - Intergenic
927640137 2:24840865-24840887 GATGGAGAGGGCAGTGCCTTCGG + Intronic
928026189 2:27741253-27741275 GAGGGAGACTGCAGGGAGGGAGG - Intergenic
928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
928605979 2:32946061-32946083 GAGGAAGACTGCTATGACTGTGG + Intergenic
928715649 2:34056697-34056719 GAGGAAGAGTGCCATGATTGTGG - Intergenic
928750136 2:34460742-34460764 AAGGGAGAGCGCGGTGATTGTGG - Intergenic
928767854 2:34670002-34670024 GAGAAAGAGTGTAGTGACTCTGG + Intergenic
928847611 2:35696690-35696712 GAGGGAGAGCAAAGTGACTGGGG - Intergenic
929017288 2:37511166-37511188 GTGGGAGAGGGGATTGACTGGGG + Intergenic
929251162 2:39757126-39757148 GAGGGAGAGAACTCTGACTGGGG + Intronic
929281838 2:40088204-40088226 GAAGGAAAGTGCAGTGACTGTGG - Intergenic
930288944 2:49468770-49468792 GAGGGAGAGCACAGTGATTGTGG - Intergenic
930439785 2:51391221-51391243 GAGGGAGAGTACAGTGACTGGGG - Intergenic
930469156 2:51791841-51791863 GAGAGAGAGTGTAGTGATTGTGG + Intergenic
930895547 2:56441413-56441435 GAGGTAGAGCACAGTGATTGTGG - Intergenic
930981272 2:57528780-57528802 GAGGGAGAGTTAAGTGATTGTGG - Intergenic
931012287 2:57930367-57930389 GAGGGAGCGCACAGTGATTGTGG - Intronic
931407013 2:61988946-61988968 GAGGGAGAGTGCAGCAATTGTGG - Intronic
932268795 2:70390917-70390939 GAGACAGAGTTCACTGACTGTGG + Intergenic
932340474 2:70960113-70960135 GAGGGACAGAGCAGAGGCTGGGG + Intronic
932517455 2:72367731-72367753 GAGGGAGAGTGCAGCAACTGGGG + Intronic
932889378 2:75579002-75579024 GAGAGAAAGTGCAGTGATTGTGG + Intergenic
933086612 2:78061242-78061264 GAGGGACAGTGAAGTGAGTGTGG + Intergenic
933351544 2:81158733-81158755 AATGGAGAGAGCAGTGACTGCGG + Intergenic
933480834 2:82855085-82855107 CAGAGAGACTGGAGTGACTGCGG + Intergenic
934124052 2:88869206-88869228 GAGACAGAGGGCAGTGATTGAGG - Intergenic
934928861 2:98404044-98404066 TGGGGAGAGTGCAGTGATTGTGG + Intergenic
935437955 2:103056899-103056921 GAGGGAGAGTGCCGTGACTAGGG - Intergenic
935835672 2:107050631-107050653 GATGGAGAGTGCAGCCACTGGGG - Intergenic
936641540 2:114317356-114317378 GAAGGAGAGCTCAGCGACTGGGG - Intergenic
936703806 2:115045581-115045603 GAGGGTGAGTGCAGTGATTGCGG - Intronic
936940505 2:117879298-117879320 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
937193958 2:120133442-120133464 GAGGGAGAGCACAGTGACTATGG + Intronic
937331017 2:121030015-121030037 GATGGAGAATGCAGTGGGTGGGG + Intergenic
937613671 2:123893906-123893928 GAGGGAGAGTGCAGATACTGGGG - Intergenic
937929155 2:127191484-127191506 TCGGGAGGGTGCAGTGGCTGCGG + Intronic
938113789 2:128589906-128589928 GAGGGAAAGTGGCTTGACTGGGG + Intergenic
938587635 2:132707206-132707228 GGGGGAAAGTGCAGTGACTGTGG + Intronic
938986313 2:136579801-136579823 CAGGGAGAAGGCAGTGGCTGGGG + Intergenic
939144422 2:138395702-138395724 GAGAGAGACTGCAGTGACTGTGG + Intergenic
939273495 2:139970322-139970344 GAGGGAGAGCACAGAGACTGGGG + Intergenic
939412391 2:141845542-141845564 TAGGGGGACTGCAGTGTCTGAGG + Intronic
939512180 2:143121052-143121074 GAGGGGGAGTGCAGTCCCTTGGG - Intronic
939610041 2:144298882-144298904 GAGAGAGAGAGCAGTGTCTCTGG - Intronic
939708028 2:145479186-145479208 GAGGAAGACTGCAGTGACTAAGG - Intergenic
940402668 2:153265476-153265498 GAGAGAGAATGCAGTGGTTGTGG - Intergenic
941461655 2:165779207-165779229 GAGGGACACTGAAGTGGCTGAGG - Intronic
941742137 2:169046598-169046620 GAGGGAGAGCACAGTGACTGTGG + Intergenic
941746095 2:169088293-169088315 GAGGGAGAGCACAGTGATTGTGG - Intronic
941851925 2:170191633-170191655 GAGGGAGAGCACAGTGATTGGGG - Intronic
942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG + Intergenic
942886020 2:180924958-180924980 GAGGCCGGGTGCAGTGACTCAGG - Intergenic
943099657 2:183472224-183472246 GAGGGAGAGTGCAGTGACTATGG - Intergenic
943117608 2:183692443-183692465 AAGGGAGAGCACAGTGAATGGGG - Intergenic
943237336 2:185338844-185338866 TAGAGAGAGCACAGTGACTGTGG - Intergenic
943844981 2:192634469-192634491 GAGGGAGAGTACAGTGATTCTGG + Intergenic
943867048 2:192938492-192938514 AAGGGAGAGTGCAGTGACTGAGG - Intergenic
943913009 2:193592440-193592462 GAGGGAGAGGACCGTGACTGGGG + Intergenic
944096051 2:195968932-195968954 GAGGGACAGCGTAGTGACTGGGG - Intronic
944133380 2:196370829-196370851 GAGGGAGAATGCAGTGATTGTGG - Intronic
944461624 2:199955823-199955845 GACCGAGAGTGCAGGAACTGGGG - Exonic
944616549 2:201465910-201465932 GAGGGAGAGTGCAGTGATTGTGG - Intronic
944760239 2:202807309-202807331 GAGGGAGAGTGCAGTGATTGTGG + Intronic
945334322 2:208573490-208573512 GAGGTAGAGTGAAGTGATTGTGG + Intronic
945430204 2:209755094-209755116 GAGGGAGGGTGCAGACCCTGGGG + Intergenic
947009274 2:225547617-225547639 GAAGGAGAGTATAGTGATTGTGG - Intronic
947131031 2:226924808-226924830 GAGGGAGAGCACAGTGATTGTGG - Intronic
947665944 2:231905298-231905320 GAGGGAGAGTCCAGCTTCTGGGG + Intergenic
947676432 2:231985230-231985252 GAGAGAGAGGGCAATGGCTGTGG - Intronic
947749846 2:232526337-232526359 GAGTGGGAGTGGAGTGAGTGAGG - Intronic
947855105 2:233318717-233318739 GAGGGAGAGAGCAGTGAGGGTGG - Intronic
948774554 2:240277080-240277102 GAGGGAGAGAGCAGTGACTGTGG + Intergenic
948871931 2:240805061-240805083 GAGGGAGAGGGCAGGGAGAGGGG + Intronic
948935606 2:241162364-241162386 GAGAGAGAGTGAACTGACAGAGG + Intronic
1168748202 20:263169-263191 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1168813543 20:721547-721569 GAGGGTCTGTGCAGTGATTGGGG + Intergenic
1168852789 20:988142-988164 AGGCCAGAGTGCAGTGACTGAGG + Intronic
1169339525 20:4785756-4785778 AAGGGATAGTGCAGTCCCTGGGG - Intronic
1169988612 20:11474247-11474269 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1170024265 20:11871987-11872009 GAGGGAGTGTGCAGAAGCTGGGG - Intergenic
1170623332 20:18011892-18011914 AAGCGAGAGTTCAGGGACTGTGG - Intronic
1170668265 20:18405885-18405907 GAGGGAGAGCACAGTGACTGGGG + Intronic
1170709363 20:18776128-18776150 GAGGGAGAGTGCAGTGATTATGG - Intergenic
1170864222 20:20138509-20138531 GAGAGAAAGTGCAGTGACTGTGG - Intronic
1171126168 20:22603736-22603758 GGGGGTGAGTGCAGTCCCTGAGG + Intergenic
1172274446 20:33672195-33672217 GATGGAGAGTGGAGAGAATGTGG - Intronic
1172838889 20:37890200-37890222 GAGGAACAGCGCAGTGAATGTGG + Intergenic
1172895947 20:38300084-38300106 GAGGGAGAGTACAGGGCCTCAGG + Intronic
1172980389 20:38937268-38937290 CTGGGAGAGTGCCATGACTGTGG + Intronic
1172989427 20:39022233-39022255 GAGGCAGAGTGCAGTTGCAGTGG - Intronic
1173569595 20:44067756-44067778 GAGGGAGAGTGCAGTGAGGAGGG + Intronic
1173628614 20:44492548-44492570 AAGAGAGAGTACAGTGTCTGTGG - Exonic
1173709697 20:45143787-45143809 GAGGGAGAGCTCAGTGCTTGTGG - Intergenic
1174253200 20:49234725-49234747 GAGAGAGAGTGCAGGGACGAGGG - Intronic
1174427358 20:50441590-50441612 GAGGGAAAGTGCAAAGACTGTGG - Intergenic
1174673817 20:52333909-52333931 GAAGGAGAGTGCAGAGAATCAGG + Intergenic
1174690931 20:52503812-52503834 GAAGAAGAGTGTGGTGACTGTGG + Intergenic
1174695410 20:52551829-52551851 GAGGCAGAGTGCAGTGATGATGG - Intergenic
1175789464 20:61732415-61732437 GAGGGATGGGGCAGTGCCTGTGG - Intronic
1175881262 20:62260658-62260680 TAGGTAGAGTCCAGTGACAGTGG + Intronic
1175940115 20:62533898-62533920 GGAGGAGGGTGCAGTGTCTGTGG + Intergenic
1176940061 21:14912638-14912660 GAGGGAGAATGCATTGATTGTGG - Intergenic
1177105067 21:16945486-16945508 GAGGAAGAGTGCAGAGACCGTGG + Intergenic
1177222331 21:18210292-18210314 GAGGGGAAGTGCCGTGATTGTGG - Intronic
1177295142 21:19163561-19163583 GAGAAAGAGTGCAGTGATTGTGG - Intergenic
1177558221 21:22718162-22718184 GAGGGAGAGTGGGGTGAAGGAGG + Intergenic
1177760654 21:25399345-25399367 GAGGGAGAACAGAGTGACTGTGG + Intergenic
1177771194 21:25518564-25518586 GAGGGGGAGCACAGTGACTGTGG + Intergenic
1177849724 21:26332457-26332479 GAGAGAGAGTGTAGTGATTCTGG + Intergenic
1178893421 21:36539400-36539422 GAGTGTGTGTGGAGTGACTGTGG + Intronic
1179652381 21:42820034-42820056 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1181519168 22:23435480-23435502 CAGGGAGTGTGCAGTGACATTGG + Intergenic
1181827474 22:25529725-25529747 GGATGAGAGTGCAGTGACTAAGG - Intergenic
1182201729 22:28578743-28578765 AAGGGAGAGTGCAGTTATTGTGG + Intronic
1183096720 22:35556478-35556500 GTGGGAGAGTCCAGTGAGTTGGG + Intergenic
1183389834 22:37539209-37539231 GTGGGAGAGGGCACTGCCTGGGG + Intergenic
1184119049 22:42438485-42438507 GAGGGAGAGGGGAGGGAGTGGGG - Intergenic
1184302842 22:43572645-43572667 GAGGGAGTGAGCAGTGACATCGG - Intronic
1184421578 22:44385462-44385484 GAGGGGGAGTGCAGCCACTGTGG - Intergenic
1184965685 22:47970333-47970355 GAGGGAGAGGGCTGTTCCTGGGG - Intergenic
949829394 3:8197632-8197654 GAGGGAGAGCACAGTGACTGTGG - Intergenic
950536801 3:13583586-13583608 GGGGGCGAGTGCAGAGCCTGAGG - Intronic
950700887 3:14745197-14745219 GAGAGAGAGAGCAGTGAGGGAGG + Intronic
950801198 3:15552975-15552997 GAGGGAGAGTGCCGTAACTGTGG - Intergenic
951029400 3:17864125-17864147 GAGGGAGAGCACAGTGACTGTGG - Intronic
951129821 3:19029371-19029393 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
951255052 3:20439050-20439072 GAAGGAGAGGACAATGACTGGGG + Intergenic
951279668 3:20732347-20732369 AAGGGAGAGTGCAGAGATTGTGG - Intergenic
951688734 3:25373373-25373395 GAAGGAGAATGCAGTGAGTGAGG + Intronic
952066560 3:29577720-29577742 GAGGGAGAATACAGCAACTGGGG - Intronic
952132931 3:30385223-30385245 GAGGGAGAGTACAGCAACTGTGG - Intergenic
952688487 3:36176246-36176268 GAGGAAAAGTGCAGTGATTGTGG - Intergenic
952725638 3:36581815-36581837 AAGGGAGAGTACAGTAATTGTGG + Intergenic
952814917 3:37438797-37438819 GAGGGAGAGTGGAGAGTCAGTGG - Intergenic
952843565 3:37668209-37668231 GAGGGACAGTGAAGGCACTGAGG + Intronic
952881373 3:37988037-37988059 GAGGGAGACTGCTGTGGCTAAGG + Exonic
953137021 3:40190114-40190136 GGGGGAGAGTGCAGAGGATGGGG - Exonic
953217187 3:40930559-40930581 GAAGGAGAGCACAGTGACTAGGG + Intergenic
953335054 3:42087434-42087456 GAGGGAGGTTTCAGTCACTGAGG + Intronic
953362508 3:42310280-42310302 GAGGGAGAGCACAATGACTGGGG - Intergenic
953410962 3:42690333-42690355 CAGTGCGTGTGCAGTGACTGTGG + Intronic
953746684 3:45579711-45579733 CAAGCAGAGTGCAGTGGCTGTGG + Intronic
953752997 3:45623713-45623735 GAGGGAGAGGGCAGAGGCAGGGG + Intronic
953899495 3:46831707-46831729 AAGGGAGATTGCACTGCCTGGGG - Intronic
954086026 3:48244752-48244774 GAGTAATAGTGCAGTTACTGTGG - Intronic
954432004 3:50475824-50475846 GAGGGAGAGGTCTGTGTCTGAGG - Intronic
954491479 3:50910710-50910732 GAGGGAGAACAAAGTGACTGTGG - Intronic
954493590 3:50930941-50930963 GCAGGAGAGGGCAGTGACTTGGG + Intronic
954853246 3:53620884-53620906 GAAGGAGCGTGCAGGCACTGAGG + Intronic
955585333 3:60471513-60471535 GAAGGAGAGTGCAGTGATTGTGG - Intronic
956222770 3:66922284-66922306 GAGGGAGAGTGCAGCAGCTGGGG + Intergenic
956588465 3:70888585-70888607 GGGGGAGAGTCCAGTGGCAGTGG + Intergenic
957018976 3:75102115-75102137 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
957369386 3:79272610-79272632 GAGACAGAGTGCAGTTATTGTGG + Intronic
957485588 3:80858412-80858434 GAGGGAGAGCACAGTGATTGAGG + Intergenic
957538099 3:81532021-81532043 GAGGGAAAACACAGTGACTGTGG - Intronic
957541817 3:81580734-81580756 GCAGGAGATTTCAGTGACTGAGG + Intronic
957907710 3:86578953-86578975 GAGGGAGAGCACAGTGACTGGGG - Intergenic
957965723 3:87320983-87321005 GAGGGAGAGTACAGTGATTGTGG + Intergenic
958147004 3:89639276-89639298 GAGAAAGAATACAGTGACTGTGG + Intergenic
958620668 3:96555238-96555260 GAAGAAGAGTACAGTGAATGTGG - Intergenic
958682690 3:97352488-97352510 GAGAGAGAATGCAGTGACTGTGG + Intronic
958760054 3:98296222-98296244 GAGGGAGAGAACACTGATTGTGG + Intergenic
958765987 3:98368336-98368358 GAGGGAGAGTGAAGTGATTGTGG - Intergenic
958839403 3:99185925-99185947 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
959126060 3:102291326-102291348 GAAGGAGAGCACAGTGATTGTGG - Intronic
959191071 3:103112398-103112420 GAGGGAGACTGCAGTGACTGGGG + Intergenic
959284963 3:104397182-104397204 GAGAGAGAGTGTAGTGACTGTGG + Intergenic
959306833 3:104677979-104678001 GAGGGAGAGTGAAGAGATAGTGG + Intergenic
959716768 3:109442441-109442463 GAGGGAGACTGCAGCAATTGTGG + Intergenic
959806711 3:110562856-110562878 GAAGGAGAATGCAGTGATTGTGG - Intergenic
959868577 3:111300353-111300375 GAAGGAGAGCACAGTGATTGTGG - Intronic
959913842 3:111794298-111794320 GAGAGAGGGTGCAGTGACTGCGG - Intronic
960862916 3:122169501-122169523 GAGGGAGAGTGCAGCAATTATGG - Intergenic
960965143 3:123099473-123099495 GAGAGAGAGTGCAGGGGATGGGG + Intronic
961569275 3:127786476-127786498 CAGGGAGAAGGCAATGACTGTGG + Intronic
962015045 3:131430947-131430969 GAGGGACAGGGCAGTGACTGTGG + Intergenic
962061817 3:131935867-131935889 AGGGGAGAGGGCAGTGAATGGGG + Intronic
962483213 3:135815811-135815833 GAGGGAGAATGCAGTGATCATGG + Intergenic
962759242 3:138493485-138493507 GAGGGAGAGCACAGCAACTGGGG - Intergenic
962767472 3:138579076-138579098 GAAGTAAAGTGCAGTGACTGTGG + Intronic
962997975 3:140650719-140650741 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
963154022 3:142077042-142077064 GAGGGAGAGCTCAGTGACTGTGG + Intronic
963299881 3:143586074-143586096 TGGGGAGAGTGCAGTGTTTGAGG - Intronic
963430572 3:145196964-145196986 GAGGGAGAGTGTGGTGATTGTGG + Intergenic
963443615 3:145373903-145373925 GAGGGATAGCACAGTGATTGTGG + Intergenic
963528852 3:146447986-146448008 GAGGGAGAACACAGTGATTGTGG - Intronic
963676129 3:148314588-148314610 AAGGGAGAGTGCAGTAATTGTGG + Intergenic
964259038 3:154812392-154812414 GAGGGAGAGCACAGTGATTGTGG - Intergenic
964583009 3:158260867-158260889 GAGGGAAAGTACAGTGATTGTGG - Intronic
964686663 3:159403486-159403508 AAGAGAGAGTGCAGTGATTGAGG + Intronic
964784192 3:160376187-160376209 GATGGAGACTGCAGTGACAAAGG - Intronic
965020204 3:163218852-163218874 GAGGGAGATTGCAGTTATTGTGG - Intergenic
965145108 3:164890815-164890837 GAGGGAGAGGGTAGTGATTGTGG - Intergenic
965256983 3:166425750-166425772 GAAGGAGAGCACAGTGACAGTGG + Intergenic
965264051 3:166518183-166518205 GAGGGAAAGTGCAGTTACTGTGG + Intergenic
965415300 3:168385162-168385184 AAGGGAGAGCGCACTGAATGGGG - Intergenic
965535363 3:169818170-169818192 GAGGGAGAGGAAAGTGACTGTGG - Intergenic
965554646 3:170006435-170006457 GAGGTAGAGTGAAGAGACTTTGG - Intergenic
965844394 3:172945579-172945601 GAGGGAGAATACAGTAATTGTGG + Intronic
965853941 3:173065697-173065719 GAGGGAAAGTAAAGTGAGTGTGG + Intronic
966141829 3:176766298-176766320 GAAGAAGAGTGCAGGGATTGTGG + Intergenic
967141971 3:186569063-186569085 GAGGGAGAGTACAGTGTTTCAGG + Intronic
967233044 3:187358999-187359021 GCTGGAGAGAGCAGTGAGTGGGG + Intergenic
967481180 3:189975152-189975174 GAGGCAGAGTCAAGTGACTTGGG - Intronic
967697062 3:192544178-192544200 GAGGGAGAGCACAGTGATTGTGG - Intronic
968762680 4:2450710-2450732 CAGGGAGGGTGCAGGGCCTGTGG - Intronic
969475788 4:7421859-7421881 GAGAGGGAGTGCAGGGGCTGGGG + Intronic
970034394 4:11716059-11716081 AAGGGAGAGGGCAGTGATTATGG - Intergenic
970442355 4:16092788-16092810 GAGAGAGAGCACAGTGGCTGGGG + Intergenic
970590056 4:17551945-17551967 GGCTGGGAGTGCAGTGACTGTGG + Intergenic
970963232 4:21897958-21897980 GAGGGAAAGTGCAGTGATTATGG + Intronic
971747554 4:30603307-30603329 GAGGGAGATTGCAGTGAGCCAGG + Intergenic
972125400 4:35758932-35758954 GAGGGAGATTGCAGTGATTGTGG - Intergenic
972162986 4:36247612-36247634 GAGGGAGAGAGGAGAGAGTGAGG - Intergenic
972253677 4:37331878-37331900 AAGGGAGAGTACAGTGATTGTGG + Intronic
972271201 4:37512036-37512058 GAGGGAGAGCACAGTGATTGTGG - Intronic
972278569 4:37582067-37582089 GAGGGAGAGTACAGTGATTTGGG - Intronic
973048542 4:45567077-45567099 GGGGCTGAGTGCAGTGCCTGTGG + Intergenic
973060525 4:45718569-45718591 GAGGGAAAGTGAAGTGATTGTGG + Intergenic
973287946 4:48440429-48440451 GAGGGAGAGCACAGTGACTGTGG - Intergenic
973348442 4:49082257-49082279 GAGGGAAAGTGCAGTGATTGTGG + Intergenic
973720834 4:53721745-53721767 GAAGGAGGGGGTAGTGACTGGGG - Intronic
973919939 4:55674327-55674349 GAAGGAGAGTACAGTGATTGTGG - Intergenic
974266904 4:59597703-59597725 GAAGGATAGTGCAGGGACTGTGG + Intergenic
975095754 4:70454454-70454476 GAGGGAGCATGCAGTGCCTGTGG - Intronic
975295138 4:72726122-72726144 GAGGGAGAGCACAGTGATTGTGG + Intergenic
975935815 4:79578751-79578773 GCTGGTCAGTGCAGTGACTGGGG + Intergenic
976179785 4:82387850-82387872 GAGGCAGAGTGCAGTGAGCCGGG + Intergenic
976444009 4:85109747-85109769 GAGGAAAAGTGTAGTGACTACGG + Intergenic
977371409 4:96141810-96141832 AAGGGAGAGGGCTGGGACTGAGG - Intergenic
977644388 4:99395644-99395666 GAGGGAGAGTGCAGTGATAGTGG + Intergenic
978387863 4:108193796-108193818 GAGTAAGAATGAAGTGACTGTGG + Intergenic
978654251 4:111048210-111048232 GAGGGAGAGCACAGTGATTGTGG + Intergenic
979184521 4:117772045-117772067 GAGGGAGAGTGCAGACATTAAGG + Intergenic
979213392 4:118133373-118133395 GAGGGAGAGCACAGTGACAGGGG - Intronic
979565190 4:122146463-122146485 GAAGGAGAGTGCAGTGATTGTGG - Intergenic
979913241 4:126396967-126396989 GAGGGATAGTGCAATGAATATGG - Intergenic
980172526 4:129306618-129306640 GAGGGAGAGCACAGTGACTGGGG - Intergenic
980752911 4:137115751-137115773 GAGGGAGAGCACAATGACTGTGG + Intergenic
980956506 4:139434026-139434048 GAGGGAGATCGCAGTGATTGTGG - Intergenic
981140121 4:141258676-141258698 GAGGGAGAACACAGTGATTGTGG + Intergenic
981286400 4:143024182-143024204 AAGGAAGAGTGTAGTGATTGTGG + Intergenic
981394596 4:144233254-144233276 GAGGGACAGTGCATTGATTGAGG + Intergenic
981871198 4:149487738-149487760 GAAGGAGAGTGCAGTGACTAGGG - Intergenic
981996045 4:150976808-150976830 GTGGGAGAGTGCAGCGACTGTGG + Intronic
982160849 4:152568048-152568070 GAGGGAGAGGGCTGTGTATGTGG - Intergenic
982683487 4:158459944-158459966 GAAGGAGAGTGCAGTGGCTGGGG - Intronic
982798117 4:159669274-159669296 GAGGGAGAGAAAAGTGAGTGTGG - Intergenic
982899627 4:160981602-160981624 GAGGCAGAGCACAGAGACTGGGG - Intergenic
983130357 4:164011908-164011930 GAGGGAGAGCAAAGTGAGTGTGG + Intronic
983338183 4:166422025-166422047 GAGGGAGAGCACAGTGACTGTGG - Intergenic
983417626 4:167479368-167479390 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
983475983 4:168212163-168212185 GAGTGAGAGGGAAGTGAGTGTGG + Intergenic
983657850 4:170101029-170101051 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
984529877 4:180902738-180902760 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
985384858 4:189434625-189434647 GAGGGAGAGCACAGTAACTGGGG - Intergenic
985670460 5:1204022-1204044 GAGAGAGAGTGCGCTGTCTGTGG - Intronic
985820580 5:2157444-2157466 GAGGGAGAGAGCACTAAGTGTGG - Intergenic
985937189 5:3106414-3106436 GAGGGAGAGGGGAGGGGCTGGGG - Intergenic
986085204 5:4437946-4437968 AAGGGAGAGTGCAGTGATTGTGG - Intergenic
986524318 5:8656674-8656696 GAGGAAGAGTGCTGAGAATGAGG + Intergenic
986548241 5:8923624-8923646 AAGGAAGAGTGCAGGGACTGTGG + Intergenic
986928548 5:12790365-12790387 GAGGGAGAGAGCTGTCAGTGGGG + Intergenic
987616002 5:20275876-20275898 GAGGGAGAGTGCAGTGATTTGGG + Intronic
987645776 5:20671243-20671265 GAGGGAGAGTGAAGTGACTGTGG + Intergenic
987886183 5:23815903-23815925 GAGGGAGAGTAAAGTGAGTGTGG + Intergenic
987903778 5:24050027-24050049 GAGGGAGAGTGGGGTGATTGTGG + Intronic
988608645 5:32704160-32704182 GAGACAGAGTGCAATGACTGTGG - Intronic
988783929 5:34548788-34548810 GAAGGACAGGGAAGTGACTGGGG + Intergenic
989200165 5:38755355-38755377 AAGGGAGAGGGCTGTGAGTGGGG - Intergenic
989657816 5:43762871-43762893 GAGGGAAAGCACAGTTACTGTGG - Intergenic
990799038 5:59578771-59578793 GAGGGAGAATGCAGATAATGTGG - Intronic
990827816 5:59922043-59922065 GAGGGAGAGTGCAGCGACTGGGG + Intronic
991209250 5:64085213-64085235 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
991395411 5:66199281-66199303 GAGGGAGAGTACAGCAATTGTGG - Intergenic
992091631 5:73322834-73322856 AGGGCAGTGTGCAGTGACTGAGG + Intergenic
992116156 5:73540390-73540412 GAGTGAGACTTCAGTGACAGAGG + Intergenic
992146212 5:73851970-73851992 GAAGGAGGGGGCAGTCACTGTGG - Intronic
992531914 5:77660117-77660139 GAGGGAAAGTGCAGTGATTGTGG - Intergenic
992934417 5:81687190-81687212 GAGGGAGAGCACAGTGACTGTGG + Intronic
993022153 5:82605112-82605134 GAAGGAGAGGGAAGTGAGTGAGG + Intergenic
993060167 5:83029485-83029507 TGGGGAGAGTGCAGTGATTGTGG + Intergenic
993138252 5:83997827-83997849 GAGGGAGAATGAAGTGATTGTGG + Intronic
993230274 5:85226569-85226591 AAGGGAGAGTGAAGTGAATGTGG - Intergenic
993256984 5:85604470-85604492 GAGGGAGGGAGCAGTGACGGTGG + Intergenic
993279263 5:85904749-85904771 GAGGGAAAGTGCAGTGACTGAGG + Intergenic
993416377 5:87638499-87638521 GAGGGAGGGTGAAGTGGGTGGGG + Intergenic
993932316 5:93954958-93954980 GAGGGAGAGCACAGTGACTGTGG - Intronic
993981134 5:94545037-94545059 GAGGGAGAGCACAGTGACTGGGG + Intronic
994217975 5:97159918-97159940 GATGAAGAGTGCAGTGACTGTGG - Intronic
994226049 5:97253170-97253192 GAGGGAAAGTACAATTACTGGGG + Intergenic
994320335 5:98387315-98387337 GAGGGGAAGTGCAGTGATTGTGG - Intergenic
994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG + Intergenic
995019716 5:107352863-107352885 AAGGGAGAGGACAGTGAGTGTGG - Intergenic
995241121 5:109885983-109886005 GAGGGAGAGTGGAGAGACGATGG + Intergenic
995265184 5:110151838-110151860 GAGGCAGAGCACAGTGACTGGGG + Intergenic
995268743 5:110195730-110195752 GAGGAAGAGTGCAGTGATTGTGG - Intergenic
995290373 5:110444375-110444397 GAGGGAGAGCTCAGTGACTGGGG - Intronic
995573287 5:113503637-113503659 AAGGGAGAGTGCAGTGATAGTGG - Intergenic
995697909 5:114900390-114900412 GAGGAAGAGTGTTGTGATTGTGG - Intergenic
995881481 5:116848758-116848780 GAGGGAGAGATGAGAGACTGTGG - Intergenic
996166513 5:120229827-120229849 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
996192669 5:120564563-120564585 AAGAGAGAGCACAGTGACTGGGG - Intronic
996459423 5:123724727-123724749 GAGGGAGAGTGCAGCGACCGGGG + Intergenic
997437823 5:133887702-133887724 CAGGGACAGTCCAGTGACTGTGG + Intergenic
998884055 5:146675810-146675832 GAGAGAGAGAGAAGTGACTGAGG - Intronic
999559447 5:152785116-152785138 GAGGGAGAGTGCACTGACTGTGG + Intergenic
1000517899 5:162262376-162262398 GAGGGTGAGCGTGGTGACTGGGG + Intergenic
1000539413 5:162521196-162521218 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1001443614 5:171764847-171764869 GAGGGAGAGAGCAGGGAGAGTGG - Intergenic
1001845254 5:174916444-174916466 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1003007006 6:2391720-2391742 GAGTGAGTGCTCAGTGACTGTGG + Intergenic
1003167723 6:3695913-3695935 GTGGGAGGATGCAGTGGCTGTGG + Intergenic
1003292850 6:4794597-4794619 GAGAGAGAGTGCAGGGACAGTGG + Intronic
1003646304 6:7915428-7915450 TAGGGAGAGAGAAGTGAATGTGG - Intronic
1003702824 6:8489158-8489180 GGCGGAGATTGCAGTGATTGGGG + Intergenic
1003857619 6:10292434-10292456 GTGGGATAGTGCAGTGGCTCTGG - Intergenic
1003957133 6:11174421-11174443 GAGGGGGAGTGCAGTAAGTGTGG + Intergenic
1004265157 6:14142964-14142986 GAGGGACTGGGCTGTGACTGTGG + Intergenic
1004685261 6:17937130-17937152 AGGCTAGAGTGCAGTGACTGCGG - Intronic
1005311620 6:24564454-24564476 GAGGGAGGCTGCAGGGAATGAGG + Intronic
1005315611 6:24599922-24599944 GCGGGAGAGTTCACTGCCTGGGG + Intronic
1006438278 6:34038158-34038180 GATGGAAAGAGCAGTGACTGAGG + Intronic
1006447265 6:34086657-34086679 GAGGGTAAGTTCAGTGGCTGGGG + Intronic
1007001768 6:38320079-38320101 GGGGGAGAGTGCTGCGATTGTGG - Intronic
1007021742 6:38528116-38528138 GAGGCAGAGTGTAGTGACTGTGG + Intronic
1008101148 6:47392496-47392518 GAGGGAGACAACAGTGACTGTGG - Intergenic
1008192266 6:48474837-48474859 GAGGAAGAATGCAGTAACTGTGG + Intergenic
1008559175 6:52706151-52706173 GAGAGAGAGAGCACTGCCTGAGG - Intergenic
1008848684 6:55997715-55997737 GAGGGAGAGTGCAGTGTTTGTGG - Intergenic
1009039464 6:58159103-58159125 GAGGCAGAATGCAGTGATTATGG - Intergenic
1009215356 6:60913943-60913965 GAGGCAGAATGCAGTGATTATGG - Intergenic
1009728138 6:67560548-67560570 GAGGGAGAGCAAAGTGATTGTGG - Intergenic
1009748207 6:67847707-67847729 GAGGGAGAGCGCAGTGACTGGGG + Intergenic
1009781673 6:68279681-68279703 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1009823749 6:68839900-68839922 GAGGGAGAGCACAGTGATTGTGG + Intronic
1009978787 6:70701665-70701687 AAGGGAGAACGCAGTGATTGTGG - Intronic
1010062273 6:71636479-71636501 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1010176989 6:73040114-73040136 GAGGAATAGTGCAGTGACCTTGG + Intronic
1010208377 6:73343139-73343161 CAGGGACAGTCCAGTGACAGTGG - Intergenic
1011398593 6:86936807-86936829 GACGGAGAGTGGAGTGGTTGGGG - Intergenic
1012003508 6:93684304-93684326 GAGAAAGAGGGCAGTGATTGGGG + Intergenic
1012047723 6:94300402-94300424 AAGGGAAAGTGCAGTTATTGTGG + Intergenic
1012824238 6:104126822-104126844 GAGGGAGATTGCAGTGATTGTGG - Intergenic
1012827232 6:104162172-104162194 GAGGGAGAACGCAGTGACCATGG + Intergenic
1013908449 6:115245935-115245957 GAGGAAGAGTACAGCGATTGTGG + Intergenic
1013932755 6:115554377-115554399 GAGGGTGACTGGAATGACTGAGG - Intergenic
1014275610 6:119384877-119384899 GAGGAAGAGTGCAGCGACTGCGG - Intergenic
1014378650 6:120711155-120711177 GACGGAGAGTCCACTGATTGTGG + Intergenic
1014830167 6:126093738-126093760 GTGGGAGAGTGCAGTTAATCAGG + Intergenic
1015392787 6:132701847-132701869 GAAGGAAAGTACAGTGATTGTGG + Intronic
1015578935 6:134702471-134702493 GAGAGAGAGTGCAGTGACTGTGG - Intergenic
1016051585 6:139535776-139535798 GTGGGATAGTGATGTGACTGTGG + Intergenic
1016457464 6:144245763-144245785 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1017650388 6:156576168-156576190 TGGGGAGAGTGAAGTGAGTGTGG + Intergenic
1017751246 6:157492209-157492231 CAGGGAGACTACAGTGGCTGGGG - Intronic
1017823727 6:158066632-158066654 CAGGGTGAGGGCAGTGACTTTGG + Exonic
1018466891 6:164056077-164056099 GAGGGAGAGGGCAGTGAGTGTGG + Intergenic
1018639001 6:165889880-165889902 GAGGGAGGGAGGAGTGAGTGAGG - Intronic
1019087002 6:169487948-169487970 TAGAGAGAGTGCTGTGTCTGTGG - Intronic
1019592113 7:1840846-1840868 CAGGGAGTGTGCAGTGACATTGG - Intronic
1019800433 7:3084399-3084421 GTGGGACAGTGCAGAGACGGGGG + Intergenic
1020485506 7:8715231-8715253 GAGGGAGAGTGTAGTGATTGTGG - Intronic
1020574936 7:9913998-9914020 AAGGGAGAGTGTAGTGATTGTGG - Intergenic
1021123628 7:16825634-16825656 GAGGGAGAATGCAGTGATTATGG + Intronic
1021214741 7:17901610-17901632 GAGGGAGAGCACAGTGATTATGG - Intronic
1021842546 7:24732627-24732649 GAGGGAGAGCACAGCAACTGTGG + Intronic
1022034252 7:26518881-26518903 GAGGGAGGGTACAGTGATTGTGG + Intergenic
1022236372 7:28465611-28465633 GAGGGAAAGTAAAATGACTGAGG - Intronic
1022542095 7:31146834-31146856 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1022770667 7:33469155-33469177 GAGGGAGAATAAAGAGACTGAGG + Intronic
1022840661 7:34161026-34161048 GAGGAAGAGGGCAGTTACAGAGG - Intergenic
1023259641 7:38345638-38345660 CAGGCAGAGAGAAGTGACTGAGG + Intergenic
1023646162 7:42318270-42318292 GAGGGAGAGTGCAGTGGTTGTGG + Intergenic
1024176463 7:46845524-46845546 GAGAGAGAGTCCAGTGGCAGAGG - Intergenic
1024369223 7:48560324-48560346 GAGGAAGAGCACAGTGACTGGGG - Intronic
1024705957 7:51959786-51959808 GAGGAAGAATGCAGTGACTGGGG - Intergenic
1025061535 7:55812847-55812869 GAGGGAGAGTGAAGTGATTGTGG + Intronic
1027288715 7:76678238-76678260 GAGGGAATGAGCAGTGGCTGAGG + Intergenic
1027523954 7:79244450-79244472 GAGGGAGAGTGCAGTGATTGTGG + Intronic
1028299658 7:89181497-89181519 AAGGGAGACTGCAGGGACCGTGG - Intronic
1028868179 7:95737093-95737115 GAAGGAGAACCCAGTGACTGTGG - Intergenic
1028929665 7:96398415-96398437 GAGGGAGAATGCAGTGATTGTGG - Intergenic
1028972467 7:96874791-96874813 GAGAGAGAGTGCAGTGATTGTGG + Intergenic
1029042611 7:97593396-97593418 GAGGGAGAGTGCAGTGGCTGTGG - Intergenic
1030662619 7:112238246-112238268 GAGGGAGAGCGCAGTAATTGTGG + Intronic
1030966189 7:115995775-115995797 GAGAAAGAGTGCAGCGACTGTGG + Intronic
1030990226 7:116290848-116290870 GTGGGACAGTGCAGTGACTGTGG + Intronic
1031167162 7:118243116-118243138 GAATGACAGAGCAGTGACTGAGG - Intergenic
1031215327 7:118883094-118883116 GAGGGAGAGCACAGTGATCGGGG + Intergenic
1031243858 7:119281648-119281670 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1031272163 7:119665714-119665736 GAGGGAAGGTGCAGTGATTGTGG + Intergenic
1031412600 7:121457441-121457463 GAGGGAGAATGCTGTGACTGTGG - Intergenic
1031721808 7:125186644-125186666 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1031732540 7:125316383-125316405 GAGGGAGAGTACAGAGATTTTGG + Intergenic
1031753664 7:125611458-125611480 GAGAGAGAGTGCAGTGATTATGG + Intergenic
1031862197 7:126993673-126993695 GAGGGAGAGCACAGTGACTGGGG + Intronic
1032003765 7:128283902-128283924 GAGGGCGACTGCTGTGACTACGG - Intergenic
1033258985 7:139826072-139826094 CAGGGAGCGAGCAGTGACTGTGG - Intronic
1033502515 7:141966089-141966111 GAAGGAGAGTGCAGTGATTGAGG - Intronic
1033506976 7:142013251-142013273 GTGGCAGAGTTGAGTGACTGAGG + Intronic
1033542475 7:142369606-142369628 TAGGGAGAGTGCAGTGACTGTGG - Intergenic
1033877774 7:145843226-145843248 GAGGGAGAGTGCAGTGATTGTGG - Intergenic
1034126285 7:148674825-148674847 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1034473439 7:151268973-151268995 GTGAAAGAGTGAAGTGACTGGGG - Intronic
1034770468 7:153769929-153769951 GAGGGACAGTGGAGTCCCTGGGG + Intergenic
1034847915 7:154464262-154464284 CAGGGAGAATGCAGTGACTGTGG - Intronic
1034960556 7:155361849-155361871 GATGGAGAGAGCAGTGAGGGAGG + Intronic
1035017949 7:155782642-155782664 GGGGGAGAGCACAGTGGCTGTGG + Intergenic
1035455755 7:159007546-159007568 GAGGGCGGGTGCAGAGACAGAGG + Intergenic
1035745389 8:1958951-1958973 GGTTGAGACTGCAGTGACTGTGG - Intergenic
1036717714 8:11141861-11141883 TAGGGAGCGGGGAGTGACTGGGG + Intronic
1037254739 8:16941133-16941155 GAGGGAGAGCACAGTGACTAGGG + Intergenic
1037529181 8:19757228-19757250 GAGGGAAAGTTCAGCGACGGCGG - Intronic
1037902116 8:22694502-22694524 GAGGGGGAGGGCAGAGACTAGGG - Intergenic
1038914386 8:32004234-32004256 GATGGAGAGGGCAGTGGATGGGG + Intronic
1039785167 8:40828385-40828407 GAAGGAGTGTGCAGTGAGTTTGG - Intronic
1039984470 8:42436187-42436209 GAGGCAGAGTGCACAGACCGAGG - Intronic
1041184484 8:55284959-55284981 GCGAGAGATTGCAGTGACTTAGG - Intronic
1041415889 8:57608738-57608760 CAGACAGAGTGCAATGACTGGGG + Intergenic
1041580014 8:59447674-59447696 GAGGGAGAGCACAGCAACTGGGG - Intergenic
1043079971 8:75754837-75754859 GAGGGAGAGTGCAGTGACTATGG + Intergenic
1043312459 8:78877194-78877216 AAGGCCGAGTGCAATGACTGGGG - Intergenic
1043600225 8:81928617-81928639 GAGGGAGAGTGCAGCAACTGGGG + Intergenic
1043819705 8:84847289-84847311 AAGGCTGAGTGAAGTGACTGTGG - Intronic
1044241342 8:89892458-89892480 GAGGAAGAGTGCAGTGATTGTGG + Intergenic
1044257449 8:90082351-90082373 GAGAGAGAGAGCAGGGATTGGGG - Intronic
1044257717 8:90084755-90084777 GAGTGAGAATGCAGTGACTAAGG + Intronic
1044497328 8:92902384-92902406 GAGGGAGAGTGCAGTGATTGTGG - Intronic
1044996024 8:97838959-97838981 TCGGGAGAATGCAGGGACTGGGG - Intronic
1045172660 8:99687635-99687657 GCGGGAGAGAGTAGTGATTGTGG - Intronic
1045592600 8:103614342-103614364 AAGGGAGAGCATAGTGACTGGGG - Intronic
1045621116 8:103979777-103979799 GAGGAAGAGCGCAGTGACTGGGG + Intronic
1046384199 8:113487326-113487348 GAGGAAGAGCGCAGTGAGTGGGG - Intergenic
1046811543 8:118538559-118538581 GAGGGAGAGCACAGTGATTGTGG - Intronic
1047534833 8:125709960-125709982 CAGCAAGAGAGCAGTGACTGAGG - Intergenic
1048118672 8:131554818-131554840 GAGGGAGAGCACAGTGACTGTGG + Intergenic
1048593757 8:135845350-135845372 GAAGCAGAGTGAAGAGACTGAGG - Intergenic
1048732996 8:137464519-137464541 GAGGGAGAAAGAAGTGACTCTGG + Intergenic
1049732536 8:144185861-144185883 GAGGGGCAGTGCAGGGACCGTGG + Intronic
1049767617 8:144362255-144362277 CAGGGAGCGTGCAGGCACTGGGG + Intergenic
1050238933 9:3613635-3613657 GAGGGAAAGTGCAGGGATTGTGG - Intergenic
1050241320 9:3638644-3638666 GAGGGAAGGTGGAGTCACTGAGG + Intergenic
1050248061 9:3713004-3713026 GTGGAAGAGTGCAGTGACTGGGG + Intergenic
1050562148 9:6845143-6845165 GAGACTGAGTGCAGTTACTGTGG + Intronic
1050618729 9:7430183-7430205 GAGACAGAGTACAGTGATTGTGG - Intergenic
1050644411 9:7703296-7703318 GAGGGAGAATACAGTCACTGAGG - Intergenic
1050857838 9:10384026-10384048 GAAGGGTAGTGCAGGGACTGAGG + Intronic
1050907013 9:11016894-11016916 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1051039220 9:12785666-12785688 GAGGGAGAATACAGTGATTATGG - Intronic
1051306617 9:15717180-15717202 AAGGGAGAGCACAGTGATTGTGG + Intronic
1051330712 9:16022456-16022478 TATGGAGAGGGGAGTGACTGGGG + Intronic
1051345608 9:16148093-16148115 GAGGGAGAGTGCAGTGGGTGGGG + Intergenic
1051405518 9:16733917-16733939 GTGGGAGAGTGCAGGGACTTAGG - Intronic
1051455186 9:17247433-17247455 GAGGCAGAGCACAGGGACTGTGG - Intronic
1052093880 9:24361732-24361754 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1052169557 9:25376971-25376993 GTGGGTGGGTGCAGGGACTGGGG - Intergenic
1052450603 9:28625285-28625307 GAGGGAGAACACAGTGACTTAGG - Intronic
1052500254 9:29280117-29280139 GAGGGATAGTCCAGCCACTGTGG + Intergenic
1052914656 9:33915464-33915486 CAGGGAGAGTGCTGAGAGTGTGG + Intronic
1054818267 9:69496522-69496544 GAGAGAGAGGGCAGTGCCTGAGG - Intronic
1055283555 9:74702811-74702833 GAAGGAGAGTGAAGTGAGTGTGG + Intergenic
1055355763 9:75435602-75435624 GAAAGGGACTGCAGTGACTGAGG - Intergenic
1056230694 9:84539729-84539751 GAGGGAGAACACAGTGATTGTGG - Intergenic
1056338702 9:85602852-85602874 GAGAGAACATGCAGTGACTGTGG + Intronic
1056516664 9:87358798-87358820 GAGAGAAAGTGCAGTGACTGTGG + Intergenic
1057241227 9:93411777-93411799 GAGAGAAAGTGCAGTGATTGTGG - Intergenic
1057289187 9:93789615-93789637 GAGAGAGAGTTCAGTGATTATGG - Intergenic
1057889454 9:98858056-98858078 GAGGGAGAGTGAAGTGAAGTTGG - Intergenic
1057895509 9:98905529-98905551 GAGGGAGGGTGCAGCGAAGGAGG - Intergenic
1057987414 9:99731495-99731517 TAGTGCGTGTGCAGTGACTGGGG + Intergenic
1058285364 9:103170066-103170088 GAGGGAGAGGGCAGTGACTGTGG - Intergenic
1059311418 9:113391148-113391170 GAGTGAGGGTGCAGTCAGTGTGG + Intronic
1059555601 9:115277132-115277154 AAGGGAGAGTGCAGTGATTGTGG - Intronic
1059838967 9:118191199-118191221 AAGAGAGAGTACAGTGATTGTGG + Intergenic
1059886565 9:118751079-118751101 GAGGGACAGCACAGTGATTGTGG + Intergenic
1059897597 9:118884486-118884508 TAGAGAGACTGAAGTGACTGTGG + Intergenic
1060212758 9:121720586-121720608 CAGGGAGTGGGCAGTGGCTGGGG - Intronic
1060328586 9:122643302-122643324 GAGGGAGAGCACAGCAACTGAGG + Intergenic
1061271675 9:129547240-129547262 GAGGGAGAGTGCAGCCCATGGGG - Intergenic
1061424319 9:130489629-130489651 GAGGGAAAGTGCAGGGCATGAGG + Intronic
1061559416 9:131393677-131393699 GATGGAGGGGGCAGTGACGGGGG - Intergenic
1061638141 9:131928556-131928578 GAGGGAGAGCACAGCGACTGGGG + Intronic
1061916043 9:133754778-133754800 GAGGGAGACAGCTGTGACTTTGG + Intergenic
1062097287 9:134709937-134709959 GTGGGAGGGTCCAGTGGCTGGGG + Intronic
1062184957 9:135213238-135213260 GCGGGAGAGTGCAGGGACCCAGG - Intergenic
1062282055 9:135756604-135756626 GATGGAGGGTGCAGTGGGTGAGG - Intronic
1062490820 9:136804087-136804109 GAGGGTGAGAGCAGTGTCTGGGG + Intronic
1186602035 X:11048607-11048629 GAGGGAGAGCACAGTGTCTGGGG - Intergenic
1186951409 X:14629437-14629459 GTGGGAGAGTTCATTGCCTGTGG + Intronic
1187075692 X:15932228-15932250 AAGGGAGAATGCAGTACCTGAGG + Intergenic
1187636676 X:21237416-21237438 GAGGGAGAACATAGTGACTGTGG + Intergenic
1187723891 X:22182389-22182411 GAAGGAGAGTACGGTGATTGTGG - Intronic
1188117785 X:26266352-26266374 GCAGAAGAGTACAGTGACTGAGG + Intergenic
1188715520 X:33455710-33455732 GAGGGAGAGTGCAGCAATTCTGG + Intergenic
1188897345 X:35685820-35685842 AAGGGAGATAGCAGTGACTGGGG + Intergenic
1188972405 X:36633563-36633585 GAGGGAGAGCACAGTGATTATGG - Intergenic
1189405608 X:40720354-40720376 GAGGGAGAGAATAGTGACTGGGG + Intronic
1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG + Intergenic
1189640649 X:43067448-43067470 GAAGGAAAGTGTAGTGATTGTGG + Intergenic
1189819297 X:44855125-44855147 GAGGCAGGGTGCAGTGGCTCTGG - Intergenic
1190374468 X:49775452-49775474 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1191145144 X:57157526-57157548 GAGAAAGAGTGCAGTCAGTGTGG - Intergenic
1191179058 X:57540119-57540141 GAAAGTGAGTGCAGTGATTGTGG + Intergenic
1191197060 X:57736026-57736048 GTGGGAGAGTTTAGTGACTGGGG + Intergenic
1191646576 X:63488144-63488166 GAGGGAGAGCGCGCTGATTGTGG + Intergenic
1191813351 X:65216316-65216338 GAGAGAGAGCGTAGTGAGTGTGG + Intergenic
1191974226 X:66852227-66852249 GAGGGAGAGTGCAGAGACTAGGG - Intergenic
1191990958 X:67036598-67036620 GAGGGAGAGCACAATGACTGGGG - Intergenic
1192046108 X:67675598-67675620 GAGGAAGATTGCAGTGACTGTGG - Intronic
1192069527 X:67922543-67922565 GAGAGAGAGTGTAGTGGTTGTGG + Intergenic
1192374755 X:70548602-70548624 AAGGGAGAGCACAGTGATTGTGG + Intronic
1192602525 X:72479865-72479887 CAGGGTGAGTTCACTGACTGAGG + Intronic
1192712673 X:73607696-73607718 GAGGGACTGTGCCGTGAGTGAGG - Intronic
1192731957 X:73809443-73809465 GATGGAGAGTGAAGCAACTGGGG - Intergenic
1192793301 X:74405734-74405756 AAGGGAGAGTGCAGTGATTGTGG + Intergenic
1192839304 X:74837103-74837125 GAGGGAGAGTGAAGTGACTGGGG - Intronic
1192875349 X:75223646-75223668 GAGGGAAACTGCAGTGATTGTGG - Intergenic
1192890814 X:75389051-75389073 GAGGGAGAGTGCAGTGACTGTGG + Intronic
1193052505 X:77116068-77116090 GAGGGAGAGTGTACTAATTGTGG - Intergenic
1193052536 X:77116266-77116288 GAGGGAGAGTGCAGCAATTGTGG - Intergenic
1193078552 X:77381996-77382018 AAGGGAGAGCCCAGTGATTGTGG + Intergenic
1193246918 X:79239789-79239811 GAGGGAGAGTGCAGCAACTAGGG - Intergenic
1193469285 X:81879195-81879217 AATAGAGAGTGAAGTGACTGTGG - Intergenic
1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG + Intronic
1193896934 X:87126495-87126517 GAGGGAGAGTGCAGTGATTATGG + Intergenic
1194251819 X:91585353-91585375 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1194327793 X:92541353-92541375 GAGGGAGAGCACAGTGACCTAGG - Intronic
1194329119 X:92559647-92559669 GAGGAATATTGCAGTGACTGGGG + Intronic
1194388929 X:93292458-93292480 GAGGGAGAATGCAGTGACTGGGG + Intergenic
1194415378 X:93605733-93605755 GAGGCAGAGCACAGTGAATGGGG + Intergenic
1194526368 X:94982842-94982864 GTGGGAAAGTGCAGTGACTGTGG + Intergenic
1194842078 X:98754822-98754844 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1195165208 X:102213233-102213255 GAAGAAGAAGGCAGTGACTGGGG - Intergenic
1195193650 X:102473858-102473880 GAAGAAGAAGGCAGTGACTGGGG + Intergenic
1195199243 X:102532132-102532154 TAGGAAGAGTGCAGCAACTGGGG + Intergenic
1195290156 X:103424429-103424451 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1195477440 X:105303043-105303065 GGAGGAGAGTGCAGTGATTGTGG - Intronic
1195489470 X:105450216-105450238 GAGGGCGAGTGCAGTGACTTGGG - Intronic
1195595330 X:106682704-106682726 GAGGGAGAGTGCAGTGATTGTGG + Intergenic
1195601224 X:106751276-106751298 GAAGGAGAGCACAGTGATTGTGG + Intronic
1195618739 X:106932836-106932858 GAGTAAGAGTTCAGTGAGTGTGG - Intronic
1196215745 X:113050048-113050070 GAGGGAGAATGCAGCAATTGTGG + Intergenic
1196217703 X:113072669-113072691 GAGGGAGAGCTCAGTGATTGTGG - Intergenic
1196224162 X:113146028-113146050 GAGGAAGAATGGGGTGACTGGGG - Intergenic
1196270184 X:113700452-113700474 GAGGGAGAGTGTAGCATCTGGGG - Intergenic
1196357471 X:114810560-114810582 GAGGGAGAATGCAGTGACTGTGG - Intronic
1196368741 X:114951973-114951995 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1196384962 X:115139689-115139711 GAGGGAGAGCACAGGGACTGGGG + Intronic
1196485705 X:116204164-116204186 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1196532643 X:116806794-116806816 GAGAGACAGCACAGTGACTGGGG - Intergenic
1197011477 X:121569973-121569995 GAGGGAAAGTACAATGATTGTGG + Intergenic
1197024870 X:121737158-121737180 AAGAGAGAGTGTAGTGATTGTGG + Intergenic
1197030596 X:121809193-121809215 GAGGGACAGTGAAGTGAATGTGG - Intergenic
1197099677 X:122637408-122637430 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1197177964 X:123504779-123504801 GAGGGAGAGCACAGTGATTTGGG + Intergenic
1197361242 X:125505592-125505614 TAGAGAGAGTGCAGTCATTGTGG - Intergenic
1197457902 X:126700978-126701000 AAGGGAGAGCACAGTGACTGGGG + Intergenic
1197623651 X:128779836-128779858 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1197670703 X:129273799-129273821 GAGGGAAAGCACAGTGATTGTGG - Intergenic
1197730662 X:129806550-129806572 GAGGAAGAGTTCAGTGTCTAAGG - Intronic
1197953033 X:131918399-131918421 AAGGGAGAGTGCAGCAACTGTGG + Intergenic
1198274124 X:135085526-135085548 GAGGGAGAGTGTAGTTATAGTGG - Intergenic
1198278063 X:135116201-135116223 GAGGGAGAGTGCAGCAAGTGGGG - Intergenic
1198292899 X:135256315-135256337 GAGGGAGAGTGCAGCAAGTGGGG + Intronic
1198761560 X:140038344-140038366 GAGGGAGAGGAAAGTGACTGTGG + Intergenic
1198770684 X:140126904-140126926 GAGGGAGAGTGTAGTGACTAGGG - Intergenic
1199188945 X:144948842-144948864 GAGGGAGAGCAAAGTGAGTGTGG + Intergenic
1199223045 X:145339713-145339735 GAGGGAGAGTGCAACAATTGTGG + Intergenic
1199277518 X:145963919-145963941 GAGGGACAGCGTAGTGACTGAGG + Intergenic
1199325090 X:146489932-146489954 GAGGGAGAGTACAGTGACTGAGG + Intergenic
1199393176 X:147305731-147305753 GAAGGACAGTGCAGTGACTTGGG + Intergenic
1199431838 X:147770666-147770688 GAGAGAGAGTTCAGTGGCTGTGG + Intergenic
1199457510 X:148045031-148045053 GAGGGAGAGCACAGTGGTTGTGG - Intergenic
1199464452 X:148120314-148120336 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1199484973 X:148337733-148337755 GAGGGAGAGCACAGAGACTGGGG + Intergenic
1199795395 X:151191063-151191085 GAGGGAGAGCAAAGTGATTGCGG + Intergenic
1199962819 X:152791772-152791794 GAGAGAGAGGGCAGTGATTGTGG + Intergenic
1200097734 X:153672069-153672091 GAGGGACTGAGCAGTGAGTGGGG - Intronic
1200177206 X:154125532-154125554 GAGGGAGGGCACGGTGACTGTGG + Intergenic
1200498111 Y:3910319-3910341 GTGTAAGAGTGCAGTTACTGTGG + Intergenic
1200570753 Y:4826584-4826606 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1200636507 Y:5660571-5660593 GAGGGAGAGCACAGTGACCTAGG - Intronic
1200637821 Y:5678837-5678859 GAGGAATATTGCAGTGACTGGGG + Intronic
1201526175 Y:14936749-14936771 GAGTGAGAGGGCAGTCACTATGG - Intergenic
1202111134 Y:21421821-21421843 GAAGGAGAGCACAGAGACTGAGG - Intergenic