ID: 942881796

View in Genome Browser
Species Human (GRCh38)
Location 2:180870665-180870687
Sequence AGGGAGAGTGCAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942881790_942881796 25 Left 942881790 2:180870617-180870639 CCTGGTAGCAGCCACCTGGCACA No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881792_942881796 11 Left 942881792 2:180870631-180870653 CCTGGCACAAAGAGAGAATCTGT No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881789_942881796 26 Left 942881789 2:180870616-180870638 CCCTGGTAGCAGCCACCTGGCAC No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881791_942881796 14 Left 942881791 2:180870628-180870650 CCACCTGGCACAAAGAGAGAATC No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data
942881788_942881796 27 Left 942881788 2:180870615-180870637 CCCCTGGTAGCAGCCACCTGGCA No data
Right 942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942881796 Original CRISPR AGGGAGAGTGCAGTGACTGT GGG Intergenic
No off target data available for this crispr