ID: 942888508

View in Genome Browser
Species Human (GRCh38)
Location 2:180958693-180958715
Sequence TCCTATTTTTAAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942888505_942888508 -2 Left 942888505 2:180958672-180958694 CCAGATTTTAAAACACTTTACTC No data
Right 942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG No data
942888504_942888508 22 Left 942888504 2:180958648-180958670 CCTGGAAATAATATTAATAATAC No data
Right 942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942888508 Original CRISPR TCCTATTTTTAAAAGGAGGA AGG Intergenic
No off target data available for this crispr