ID: 942890633

View in Genome Browser
Species Human (GRCh38)
Location 2:180982073-180982095
Sequence GAGAGCCCCAGCACCAGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 2, 1: 0, 2: 0, 3: 40, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942890629_942890633 12 Left 942890629 2:180982038-180982060 CCAAGATGTCCAGTGATAGGCAA 0: 2
1: 0
2: 1
3: 13
4: 215
Right 942890633 2:180982073-180982095 GAGAGCCCCAGCACCAGCAGTGG 0: 2
1: 0
2: 0
3: 40
4: 358
942890627_942890633 28 Left 942890627 2:180982022-180982044 CCAAGAGATAACTTCACCAAGAT 0: 1
1: 0
2: 2
3: 22
4: 166
Right 942890633 2:180982073-180982095 GAGAGCCCCAGCACCAGCAGTGG 0: 2
1: 0
2: 0
3: 40
4: 358
942890631_942890633 3 Left 942890631 2:180982047-180982069 CCAGTGATAGGCAAAGGTCCGAT 0: 2
1: 0
2: 0
3: 3
4: 38
Right 942890633 2:180982073-180982095 GAGAGCCCCAGCACCAGCAGTGG 0: 2
1: 0
2: 0
3: 40
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942890633 Original CRISPR GAGAGCCCCAGCACCAGCAG TGG Exonic
900000331 1:11287-11309 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
900020045 1:181806-181828 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
900399587 1:2467523-2467545 CTGAGCCCCAGCCCGAGCAGGGG - Intronic
900505502 1:3028249-3028271 GAGAGCGGCAGCTGCAGCAGAGG - Intergenic
900548628 1:3242409-3242431 GAGAGCTCCAGCACCACCACTGG + Intronic
900732373 1:4270757-4270779 GAGAGCCCTAGCATCAGGTGTGG + Intergenic
901474901 1:9482840-9482862 GAGAGCCCCTCCATCAGCAGAGG - Intergenic
902124879 1:14201020-14201042 GAGAGGCCATGCACCAGGAGAGG - Intergenic
902441618 1:16433728-16433750 GGAAGCCCCAGCCCTAGCAGAGG + Intronic
902837079 1:19054243-19054265 GAGACACCCAGCCCCAGCATAGG + Intergenic
902983986 1:20144269-20144291 CAGAGCCCCGGCTGCAGCAGTGG - Intronic
903211493 1:21821791-21821813 GAGAGCAACAGCACCAGAGGAGG - Intronic
904407629 1:30303523-30303545 GAGACCCCCAGCTACTGCAGTGG + Intergenic
905198866 1:36302958-36302980 GAAAGCCCCAGCCCCAACATTGG + Intronic
906781916 1:48580236-48580258 CAGAGCTCAAGCACCAGGAGAGG + Intronic
907459147 1:54594802-54594824 GAGAGGCCCAGGGCCACCAGTGG - Intronic
907508832 1:54943464-54943486 GAGAACCACTGCCCCAGCAGAGG - Intergenic
907884058 1:58577092-58577114 GCCAGCACCAGCAGCAGCAGCGG + Exonic
910077483 1:83298358-83298380 GAGTGCCCCAGCTGCAGAAGTGG + Intergenic
910323501 1:85976665-85976687 GAGAGCACCAGCTGCAGTAGTGG - Intronic
911015064 1:93323367-93323389 TAGAGCCCCAGCAGGAGCAGGGG - Intergenic
911370518 1:96989462-96989484 GACAGTCACAGCCCCAGCAGAGG + Intergenic
914226138 1:145721021-145721043 GTGAGCCCCAGCGCGGGCAGGGG - Intronic
915539087 1:156556533-156556555 CAGTGCTCCAGCAGCAGCAGGGG - Exonic
917098717 1:171425218-171425240 CCCAGCCCCAGCACCAGCCGAGG - Intergenic
917920131 1:179743868-179743890 GCGAGGCGCAGCAGCAGCAGCGG - Intronic
919745973 1:201009401-201009423 GAGAGCCCCAGGTCCTGCTGGGG - Exonic
919770454 1:201155012-201155034 GCCAGGCCCAGCACCAGCATGGG - Intronic
919805795 1:201380443-201380465 CAAAGCCCCAGCACTAGCAGTGG + Intronic
919861313 1:201740807-201740829 GAGAGTCCCAGGGCCAGCTGTGG - Intronic
919871258 1:201823203-201823225 GAGAGCCACAACTCCAGGAGAGG + Exonic
919879502 1:201892399-201892421 GGGAGGGCCAGCACCAGCATCGG + Intergenic
920051699 1:203168269-203168291 CAGAGCCTCAGAACCACCAGGGG + Intronic
922207853 1:223464265-223464287 GAGAGCGCCAAGAGCAGCAGAGG - Intergenic
922930142 1:229382447-229382469 TACACCCCCAGCACCAGCAAGGG + Intergenic
923384753 1:233454996-233455018 CAGAGCCCCAGCTGCAGCAATGG - Intergenic
923559378 1:235027201-235027223 TTGATCCCCAGCACCACCAGTGG - Intergenic
924511230 1:244730550-244730572 GCGCGGTCCAGCACCAGCAGCGG + Intergenic
924624399 1:245687445-245687467 GACAGGCTCAGCAGCAGCAGCGG + Exonic
1063077569 10:2732143-2732165 GAGAGCCCATGCCTCAGCAGTGG - Intergenic
1063653666 10:7965451-7965473 GAAAGCCCCAGCACCCCCACTGG + Exonic
1063989274 10:11542806-11542828 GAGACCCCCAGCAACAGGAATGG + Intronic
1064207325 10:13335259-13335281 GACATCCCCAGCCACAGCAGAGG + Intronic
1064619580 10:17201606-17201628 TATAGCTCCAGCACCCGCAGGGG + Exonic
1066703855 10:38156998-38157020 GAGGGCCCCAGCGGCAGGAGGGG - Intergenic
1068301211 10:55143070-55143092 GAGAGCGCGAGCGCGAGCAGGGG - Intronic
1069943282 10:71969705-71969727 GACAGCCCCGGCCCCTGCAGTGG - Intronic
1070164462 10:73887492-73887514 CAGAGCCCCAGAAACAGCTGAGG + Intergenic
1070247147 10:74743515-74743537 CAGAGCCCCAGCACAGGCATGGG - Intergenic
1071490352 10:86131997-86132019 GAGGGTCACAGCACAAGCAGTGG + Intronic
1072102318 10:92240288-92240310 CCCAGCCCCAGCAGCAGCAGCGG - Exonic
1072747228 10:97949321-97949343 GACAGACCCTGCACCAGGAGGGG + Intronic
1074415360 10:113262700-113262722 GAGAGGCCCAGAACCAGAGGAGG + Intergenic
1074987668 10:118671932-118671954 GACAGCCCCAGCACCAGCTCCGG + Intergenic
1075321301 10:121493573-121493595 GAAAGCACCAGAAACAGCAGCGG - Intronic
1075726263 10:124612457-124612479 GAGAGCCCCAGGAGCAGGAAGGG - Intronic
1075731077 10:124637215-124637237 GTGAGGCCCAGCACCAGCAAGGG - Intronic
1075768732 10:124916346-124916368 GATAGCCCCAGCAAAGGCAGGGG + Intergenic
1075897955 10:126014149-126014171 GAGACCCCCAGCAGCAGAAAGGG - Exonic
1076032816 10:127173994-127174016 GAAAGGCCCAGCTCCAGCAGTGG - Intronic
1076063381 10:127430160-127430182 GTGAACCCCAGCACCACCAGGGG - Intronic
1076358728 10:129871376-129871398 GACATCCACAGCAGCAGCAGGGG + Intronic
1076727337 10:132419745-132419767 GAGAGGCCCAGGACCAGCTCCGG - Intergenic
1076812995 10:132898826-132898848 GGGTGCACCAGCACCAGCCGAGG - Intronic
1076977984 11:189820-189842 CAGTGCCCCGGCGCCAGCAGGGG - Intronic
1076982449 11:211949-211971 CTGGACCCCAGCACCAGCAGTGG - Intronic
1077218084 11:1403399-1403421 TCCAACCCCAGCACCAGCAGGGG - Intronic
1077663583 11:4089870-4089892 GAGAACCTCAGCAAAAGCAGAGG - Intronic
1078354903 11:10626153-10626175 GAGAGCCCTCGCAGCAGCGGGGG + Exonic
1078931111 11:15912759-15912781 CAGACCCCTAGCACCAGCACAGG + Intergenic
1083631996 11:64100547-64100569 CAGAGCCACAGCACCCCCAGTGG - Intronic
1083665469 11:64271790-64271812 CACAGCCCCAGCGCCTGCAGAGG + Exonic
1084435441 11:69136695-69136717 GAGAAACCCAGGACCAGCAGAGG + Intergenic
1084664579 11:70569540-70569562 GAGGGCTGCGGCACCAGCAGAGG - Intronic
1085047982 11:73364276-73364298 GAGAGCCCCAACACCAGTAAGGG - Intronic
1085580796 11:77648729-77648751 CAGAGCCCCAGCACCTGGGGAGG + Intergenic
1085702411 11:78756774-78756796 GAGGGCCCCAGCTCCAGCCAGGG - Intronic
1089362714 11:117901684-117901706 GACATCCACGGCACCAGCAGGGG + Intronic
1090802212 11:130179965-130179987 TAGAGCCCGAGCACCTGCAAGGG - Intronic
1090977558 11:131690340-131690362 GTGAACCCCAGTACCAGAAGAGG + Intronic
1091304552 11:134529349-134529371 GAGAGCCACTGCATCAGCAGCGG - Intergenic
1091373421 12:11418-11440 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
1092001095 12:5033000-5033022 GCCAGCCCCAGCCCCGGCAGCGG + Intergenic
1092237766 12:6820701-6820723 GGGAGCCCCAGCAGCAATAGGGG - Exonic
1092523207 12:9294005-9294027 GAGAGGCACAGCAACGGCAGGGG - Intergenic
1092544085 12:9437894-9437916 GAGAGGCACAGCAACGGCAGGGG + Intergenic
1095312067 12:40711125-40711147 GAGATCCACAGCACCAGTAGAGG - Intronic
1095857215 12:46873588-46873610 GAGAGGAGCAGAACCAGCAGAGG + Intergenic
1096324184 12:50643788-50643810 GAGACCCGCAGCCCCTGCAGAGG + Intronic
1096531805 12:52247320-52247342 GCAACTCCCAGCACCAGCAGGGG + Intronic
1096871051 12:54592382-54592404 GTGAGCCCCAGAAGCAGCATTGG + Intergenic
1097828947 12:64203429-64203451 AAGATCCACAGCACCTGCAGAGG + Intronic
1101221284 12:102643969-102643991 CAGAGCCCAGGCACAAGCAGAGG - Intergenic
1102462616 12:113109495-113109517 TGGTTCCCCAGCACCAGCAGAGG + Intronic
1102632818 12:114296674-114296696 GACAGCCTCAGAACCAGAAGAGG - Intergenic
1102962181 12:117099860-117099882 GAAAGCCCCAGCACCTTCTGAGG + Intergenic
1103308917 12:119989315-119989337 GGCAGCCCCAGCAGCAGCGGCGG - Intergenic
1103541421 12:121669115-121669137 GAGGGTCTCAGGACCAGCAGTGG - Intronic
1104678782 12:130734256-130734278 GAGAGCTCCAGCACAGGCACTGG - Intergenic
1104746371 12:131213521-131213543 GAGAGAATGAGCACCAGCAGGGG + Intergenic
1104843471 12:131835311-131835333 CAGGGCCCCAGCACCAGCCCGGG - Intronic
1104879956 12:132063911-132063933 AAGAGTCCCAGGCCCAGCAGAGG + Intronic
1105213397 13:18271077-18271099 AAGAACCCCATCTCCAGCAGTGG + Intergenic
1105639792 13:22250366-22250388 GAGTGCACAGGCACCAGCAGGGG - Intergenic
1105930635 13:25048828-25048850 GAGTGCCCCAACAGCAGAAGTGG + Intergenic
1106971707 13:35148119-35148141 AAGAGCCCGAACACCAGCTGGGG - Intronic
1110286391 13:73754435-73754457 GAGAGGGCCAGCAGCAGGAGAGG - Intronic
1111702146 13:91704458-91704480 GGGGGCCCCATGACCAGCAGAGG - Intronic
1113200788 13:107866366-107866388 AGGAGCACCAGCAGCAGCAGCGG - Exonic
1113482796 13:110633967-110633989 GACAGCCCCCGCCCCAGCAAGGG - Intronic
1113511004 13:110854897-110854919 GAAAGACCCAGACCCAGCAGGGG - Intergenic
1113664366 13:112131235-112131257 CAGAGCCAGAGCAGCAGCAGTGG - Intergenic
1113767160 13:112888733-112888755 GGGAGCCCCAGCATCAGCGCGGG - Intergenic
1114760507 14:25308729-25308751 GAGAGCACCAGCTACAGTAGTGG - Intergenic
1114836331 14:26206867-26206889 GACAGCCCCAGAACCAGAATAGG - Intergenic
1116685774 14:48036258-48036280 GAGAGCCACACCCCCAGCAAAGG - Intergenic
1118056474 14:62084280-62084302 GAGAGCCCCACCAACAGCTCTGG - Exonic
1119348289 14:73944056-73944078 GAGGGCCTCTGCACCAGCACAGG - Intronic
1121309537 14:92928152-92928174 GAGAGACACACCACCACCAGTGG - Intronic
1121525169 14:94614457-94614479 AAGAGCCCCAGAGCCAGGAGAGG - Exonic
1121529194 14:94640727-94640749 GAGAGCCCCAGGAGTGGCAGCGG - Intergenic
1121731191 14:96188304-96188326 GAGAGTTCCAGGACTAGCAGAGG + Intergenic
1122799967 14:104224611-104224633 GGAAGCCCAAACACCAGCAGGGG - Intergenic
1122819094 14:104332324-104332346 CAGAGACTCAGCAGCAGCAGAGG - Intergenic
1122925775 14:104899117-104899139 CACAGCCCCAGCGCCGGCAGAGG + Intergenic
1123129171 14:105972091-105972113 CAGAGCCCCAGCAGCAAGAGGGG + Intergenic
1123409695 15:20048260-20048282 CAGAGCCCCAGCAGCAAGAGGGG + Intergenic
1123784043 15:23650905-23650927 GAGAGCCCCAGGAACAGCCTGGG - Intergenic
1123831810 15:24146941-24146963 TAAAGACCCAGGACCAGCAGAGG - Intergenic
1123836788 15:24202957-24202979 TAAAGACCCAGGACCAGCAGAGG - Intergenic
1123846053 15:24303063-24303085 TAAAGACCCAGGACCAGCAGAGG - Intergenic
1123865093 15:24510774-24510796 TAAAGACCCAGGACCAGCAGAGG - Intergenic
1124125788 15:26937307-26937329 GAGAACATCAGCACCAGCACAGG + Exonic
1124689056 15:31806595-31806617 TTGACCCCCAGGACCAGCAGTGG - Intronic
1124695043 15:31857450-31857472 GAGAACCCAAGTGCCAGCAGAGG - Intronic
1125688066 15:41575406-41575428 GACAGCACCAGCTCCAGCTGGGG - Intronic
1126758745 15:51949914-51949936 GAGAGAAACAGCACCAGCGGGGG - Exonic
1127147065 15:56035505-56035527 AAGAGACCCAGAACCAGCATGGG + Intergenic
1127471695 15:59295973-59295995 GAGGGAACCAGAACCAGCAGTGG + Intronic
1127571845 15:60251287-60251309 GGGATTCCCATCACCAGCAGAGG + Intergenic
1127663682 15:61123735-61123757 GAGAAGCACAGCTCCAGCAGAGG + Intronic
1128252149 15:66171139-66171161 AAGAGCCACAGCAGCAACAGCGG - Intronic
1129189023 15:73927019-73927041 GCGCGCCCCAGGCCCAGCAGCGG + Exonic
1129490893 15:75924558-75924580 GAAAGCCCCAGCTGCAACAGAGG + Intronic
1129741824 15:77992985-77993007 GAGAGCACGAGCGGCAGCAGTGG - Intronic
1131067198 15:89442145-89442167 GAGAACCCCAGCACCAGCCCCGG - Intergenic
1131080549 15:89531035-89531057 GATAGCAGCAGCACCAGCTGGGG + Intergenic
1131092162 15:89631393-89631415 GCAAGGCCCAGCACCCGCAGAGG + Intronic
1131268913 15:90934954-90934976 TAGAGGCCCAGCACTAGGAGCGG - Intronic
1131558426 15:93418886-93418908 GAGAGAACGAGTACCAGCAGGGG - Intergenic
1132070876 15:98775658-98775680 CAGGGACCCAGCACCAGCAGGGG - Intronic
1132453176 15:101979658-101979680 CAGTGCCCCGGCGCCAGCAGGGG + Intergenic
1132453720 16:10968-10990 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
1132626826 16:895236-895258 GGGAGCCCCAGCTCCAGCCTCGG + Intronic
1132750894 16:1457136-1457158 GAGAGCCCCAGCCCCATCTGAGG - Intronic
1133303321 16:4795982-4796004 GGGAGCTGCAGCAGCAGCAGTGG - Exonic
1134023094 16:10934827-10934849 GAGGGCACCAGCACCATCTGGGG + Intronic
1135958640 16:26977528-26977550 GTGAGCCCCAGCACCCGATGTGG - Intergenic
1136556470 16:31010434-31010456 GAGACCCGGAGCAGCAGCAGAGG - Exonic
1136871113 16:33808775-33808797 CAGAGCCCCAGCAGCAAGAGGGG - Intergenic
1137958081 16:52853070-52853092 GAGAGCAGCATCACCACCAGTGG + Intergenic
1139636924 16:68263809-68263831 GAGAGCCCCAGAGCCACCAGAGG + Intergenic
1139650452 16:68359596-68359618 CAGGGCACCAGCACCAGGAGGGG + Exonic
1140196345 16:72858811-72858833 CAGAGCCCCAGGCCCTGCAGCGG + Intronic
1140231699 16:73122715-73122737 GTGAGCCCCAGAAGGAGCAGAGG + Intergenic
1141649829 16:85386948-85386970 GGGAGCCCCAGAACCTTCAGTGG - Intergenic
1141946055 16:87310853-87310875 GAAAGCAGCAGCAGCAGCAGTGG + Intronic
1141961074 16:87409666-87409688 GAAAGAGTCAGCACCAGCAGAGG - Exonic
1142051898 16:87964557-87964579 GAGAGCCCCAGGGGCTGCAGAGG + Intronic
1142373899 16:89697171-89697193 GAGAGTCCCACCTCCAGCAAGGG + Exonic
1203101059 16_KI270728v1_random:1307283-1307305 CAGAGCCCCAGCAGCAAGAGGGG + Intergenic
1142465408 17:134285-134307 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
1143014186 17:3882968-3882990 GGGCTCCCCAGCACCAGAAGCGG + Intronic
1144573745 17:16416298-16416320 GAGAGGAGCGGCACCAGCAGAGG - Intronic
1144631003 17:16872472-16872494 GAGAGTCCCTGCCCCAGGAGAGG + Intergenic
1145004679 17:19330710-19330732 GTGAGCCACTGCACCGGCAGGGG - Intronic
1145052209 17:19671471-19671493 GAGAGCCACAGCTCTAGAAGAGG + Intronic
1147934896 17:44005721-44005743 GGCAGCCCCAGGACCACCAGCGG - Exonic
1147947648 17:44089020-44089042 AAGAGCCCTGGCACCAGAAGAGG - Intronic
1151791060 17:76306340-76306362 AAGAGGCCAAGCCCCAGCAGGGG - Intronic
1152710761 17:81869645-81869667 GAGGGCCCCACCCCCACCAGTGG + Intronic
1153948622 18:10038468-10038490 ACTAGCACCAGCACCAGCAGGGG - Intergenic
1154174500 18:12076596-12076618 GAGAGCGGCAGCAGCAGCGGCGG + Intergenic
1154292424 18:13121392-13121414 GAAAGCTCCAGCACTAGCACAGG + Intronic
1159025721 18:63180708-63180730 GAGAGCCCCATCACTAGTAGGGG - Intronic
1160125229 18:76165599-76165621 GACAGCCCAGCCACCAGCAGTGG - Intergenic
1160298168 18:77656360-77656382 CAGAGCCCTTGCACCTGCAGAGG - Intergenic
1160377275 18:78422547-78422569 GAGAGCCACAACCCCAGCTGGGG + Intergenic
1161057552 19:2198305-2198327 GGGTGGCCCAGCACCTGCAGAGG + Intronic
1161324910 19:3658918-3658940 GAGAGCCCCAGCACCGACGAAGG - Intronic
1161500888 19:4614934-4614956 GAGATCCCCAGCCCCAGGAAAGG + Intergenic
1161877965 19:6926540-6926562 GAGATCACCACCACCAGCATCGG - Exonic
1163440655 19:17320938-17320960 GAGATCCCCACCACCACCAGTGG - Exonic
1163536667 19:17880871-17880893 AAGATGTCCAGCACCAGCAGAGG - Exonic
1163862618 19:19750134-19750156 CACAGCCCCAGGACCATCAGTGG + Intergenic
1164513817 19:28917719-28917741 GAGAGCCCCTTCCCCAGCTGAGG - Intergenic
1165120621 19:33556355-33556377 CACACCACCAGCACCAGCAGGGG - Intergenic
1165831967 19:38734966-38734988 CAGAGCCCTAGCTCCAGGAGTGG + Intronic
1166218891 19:41353111-41353133 GAGACCCCCAGCCCCTGCAGGGG - Exonic
1167049633 19:47070580-47070602 GAGAACCCCAGCACCTACTGTGG + Intronic
1167311232 19:48739058-48739080 CACAGCTCCTGCACCAGCAGCGG + Exonic
1168339367 19:55614613-55614635 GGGCACCCCAACACCAGCAGGGG - Exonic
1168670426 19:58237459-58237481 CAGAGCCACAGCACTCGCAGAGG - Intronic
925286026 2:2716285-2716307 GAGAGCCCCAGAGCTAGCACAGG + Intergenic
925291068 2:2749030-2749052 CAGAGTTCCAGCACCAGCAATGG + Intergenic
926352706 2:12011350-12011372 GAGAACCCCTGCACTAGGAGAGG - Intergenic
927518870 2:23687518-23687540 GTGAGCCCCGGCCCCAGGAGGGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928451681 2:31383627-31383649 GTGAGCCCCAGGAGAAGCAGGGG + Intronic
929173846 2:38958102-38958124 GACAGCCTCAGGACCTGCAGTGG - Exonic
929660007 2:43774485-43774507 GCGAACCCCCGCACCAGGAGGGG - Intronic
930700715 2:54456402-54456424 GTGAGCCCCGGCCCCAGCCGCGG + Exonic
932208172 2:69902330-69902352 AAGAGCAGCAGCAGCAGCAGCGG - Intronic
932284210 2:70518831-70518853 GCAAACCCCAGCCCCAGCAGAGG - Intronic
932331778 2:70901856-70901878 GGGAGACCCAGCGCCAGAAGAGG + Intronic
933760527 2:85668903-85668925 GAGAGCCCCTGCAGCTGCAGAGG - Intergenic
934300926 2:91775667-91775689 AAGAACCCCATCTCCAGCAGCGG - Intergenic
935283286 2:101538580-101538602 GAAAGCAGCAGCAGCAGCAGTGG + Intergenic
936057265 2:109270461-109270483 CAGAGCCCCAGCTCAGGCAGTGG - Intronic
936529910 2:113268937-113268959 GACAGCCCCATGGCCAGCAGTGG + Intronic
936569393 2:113602129-113602151 CAGTGCCCCGGCGCCAGCAGGGG + Intergenic
936951558 2:117982823-117982845 GTGAGTCCCAGGGCCAGCAGGGG + Intronic
937325955 2:120989674-120989696 CTGAGCCCCAGCACCATCAGTGG + Exonic
937361694 2:121234119-121234141 GAGTGCCCCTGCAGCAGAAGCGG - Exonic
937439258 2:121902920-121902942 GGGAGCCGCAGCATCGGCAGGGG - Intergenic
938919802 2:135985241-135985263 TAGAGCCCTTGCCCCAGCAGTGG - Intronic
939364941 2:141219254-141219276 GATCTCCCCAACACCAGCAGTGG - Intronic
939426718 2:142047859-142047881 GAGACCTCCAGGACCAGCACTGG + Intronic
940181701 2:150941502-150941524 GAGAGCACAAGCGCCACCAGTGG - Intergenic
942890633 2:180982073-180982095 GAGAGCCCCAGCACCAGCAGTGG + Exonic
943597914 2:189879600-189879622 AACAGCCCCAGCACCACCCGCGG + Intronic
946310956 2:218882402-218882424 GAGAGTCCCATCTTCAGCAGAGG + Exonic
947735787 2:232454739-232454761 GAGAGCCCCAGGACGACCACCGG + Intergenic
947805643 2:232966175-232966197 GAGAGCCCAAACAGCAGCTGGGG - Intronic
948801172 2:240434346-240434368 GAGAGCCCCAGGCACAGAAGGGG + Intergenic
948942594 2:241203736-241203758 GAGACCCCCACCAGCAGAAGCGG - Intronic
949000542 2:241610496-241610518 AAGAGCTCCAGCAAGAGCAGAGG + Intronic
1168819895 20:765671-765693 GGCAGCTCCATCACCAGCAGGGG + Exonic
1169264416 20:4158908-4158930 GAGACACCCAGCACCACCAAGGG + Intronic
1169471035 20:5885847-5885869 CAGAGGACCAGCACCAGCACCGG - Intergenic
1169925328 20:10777753-10777775 GTGAGCCCCACCACCCACAGCGG - Intergenic
1171165480 20:22966871-22966893 GAGTGCCCCAACAGCAGAAGTGG + Intergenic
1171170173 20:23008912-23008934 GAGACCCCCAGCAGCAGCGGAGG + Intergenic
1171368600 20:24645450-24645472 GAGAGCCACAGCCACAGCTGTGG - Intronic
1171770495 20:29319379-29319401 GAGAGCCCCGGCTCCTGGAGCGG - Intergenic
1173747324 20:45447860-45447882 GAGAGCCTCAGCATCAGAGGAGG - Intergenic
1173758393 20:45538402-45538424 GAGAGCCACAGCACCTCCTGGGG - Intronic
1173946789 20:46957852-46957874 GAGAGCCCTAGAACCCTCAGTGG - Intronic
1174722447 20:52827505-52827527 GAGAGCCCCCACACCATCATGGG - Intergenic
1175514591 20:59561009-59561031 GAGACCCCCTGGCCCAGCAGTGG + Intergenic
1175839940 20:62020269-62020291 AAGAGCCCCCCCACCGGCAGAGG - Intronic
1175953477 20:62596172-62596194 GCCAGCCTCAGCACCAGGAGAGG + Intergenic
1179728472 21:43354020-43354042 GAGGGCCCCAGCACCAGGAAGGG + Intergenic
1179941445 21:44641055-44641077 CAGAGCCCCAGCATCAGCTCTGG + Intronic
1180077202 21:45468885-45468907 GAGAGCCCCCACCCCAGCTGTGG + Intronic
1180816229 22:18791477-18791499 AAGAACCCCATCTCCAGCAGCGG + Intergenic
1181202418 22:21225809-21225831 AAGAACCCCATCTCCAGCAGCGG + Intronic
1181306163 22:21918393-21918415 GAGAGATCCACCAGCAGCAGGGG - Intergenic
1181308938 22:21933324-21933346 GAGAGTCCCAGCCTCTGCAGCGG - Intronic
1181432145 22:22888126-22888148 GCCAGACCCAGCAGCAGCAGGGG - Exonic
1181521901 22:23452990-23453012 GAGGACCCCAGCACCTGGAGGGG - Intergenic
1181542323 22:23580096-23580118 GCCAGACCCAGCAGCAGCAGGGG + Exonic
1181586940 22:23857773-23857795 GAGAGCGGCCGCACCAGCTGAGG - Intronic
1181699288 22:24610805-24610827 AAGAACCCCATCTCCAGCAGCGG - Intronic
1183325313 22:37188263-37188285 CAGACCCCCAGGCCCAGCAGAGG + Exonic
1183528078 22:38336102-38336124 GTGAGCGCCAGCAGCAGCTGGGG - Intronic
1183579169 22:38713183-38713205 GAGAACCCCAGCACAAGGAAGGG + Intronic
1184107121 22:42374354-42374376 CAGAGCCCCAGAAGCAGGAGAGG - Intergenic
1184785783 22:46671108-46671130 GAGAGCCCAAGTCCCAGCTGGGG - Intronic
1184859819 22:47166926-47166948 CAGAGCTCCAGCACCAGGCGGGG + Intronic
1203224495 22_KI270731v1_random:69604-69626 AAGAACCCCATCTCCAGCAGCGG - Intergenic
1203266332 22_KI270734v1_random:17188-17210 AAGAACCCCATCTCCAGCAGCGG + Intergenic
950199615 3:11033980-11034002 GTGAGCCCCAGATCCTGCAGCGG - Intronic
950304605 3:11908240-11908262 CTGAGCACCAGCAGCAGCAGTGG + Intergenic
950550791 3:13664754-13664776 GTGAGGCCCTGCACCAGCTGGGG - Intergenic
950696458 3:14704474-14704496 GAGAGTCTGAGCACCTGCAGTGG - Exonic
951567003 3:24020511-24020533 GAGAACACCAGCTGCAGCAGGGG - Intergenic
953207838 3:40847839-40847861 CAGAGCCTCAGCACCTGCTGTGG - Intergenic
953432383 3:42850760-42850782 GAGAGCTCCTGACCCAGCAGGGG + Intronic
954628017 3:52033284-52033306 GACACCCCCAGCACCTGCTGCGG + Intergenic
960844482 3:121993690-121993712 GTGACTCCCTGCACCAGCAGTGG - Exonic
961488105 3:127231746-127231768 CTGAGCCCCAGCATCACCAGTGG + Intergenic
961631356 3:128301396-128301418 CAGAGCCCCAGGCCCAGGAGAGG - Intronic
962794026 3:138835185-138835207 GAGAGACCCATCACCCGCTGCGG + Intergenic
963640733 3:147858500-147858522 GACTGCCCCAGCTCCAGCTGCGG - Intergenic
963942797 3:151111788-151111810 GAGAGCCACAGACCCACCAGAGG - Intronic
964408076 3:156370760-156370782 AAGAGACCCAGAACCAGCAAAGG + Intronic
966254253 3:177899453-177899475 GGGCCACCCAGCACCAGCAGAGG - Intergenic
966863583 3:184243980-184244002 GGCAGCCCCAGCACCACCTGAGG + Exonic
966921084 3:184611878-184611900 GATAGGCCCAGCACTTGCAGAGG + Intronic
967123705 3:186406331-186406353 GGGAGGCCCAGCACTGGCAGGGG - Intergenic
968574511 4:1358991-1359013 GAGAGCCTCAGCACGAGCACCGG - Intronic
968986766 4:3879892-3879914 GAGAGCCGCAGCCCCAGCGTGGG + Intergenic
969533022 4:7740046-7740068 GAGACCCCCTGCACCTGCACGGG + Intronic
970806741 4:20045476-20045498 GAGAGCCCAAGCAGCAGGAAAGG - Intergenic
971018957 4:22515726-22515748 GAGAGCGGCAGCAACAGCGGCGG + Exonic
971304430 4:25467322-25467344 AGCAGCCCCAGCCCCAGCAGTGG + Intergenic
975491284 4:74991524-74991546 GAGAGCTCCAGAACCTGAAGAGG + Intronic
975809007 4:78145907-78145929 AAGAGAACGAGCACCAGCAGGGG - Intronic
976226282 4:82797887-82797909 GAGAGCCCCAGGGACCGCAGAGG + Intronic
977689824 4:99894147-99894169 GAGTGCCCCAGCACCCCCACAGG + Intronic
978390732 4:108222634-108222656 CACAGACCCAGAACCAGCAGGGG + Intergenic
982296294 4:153833097-153833119 GACAGCCCCTGAACCAGAAGAGG - Intergenic
984708113 4:182862656-182862678 CAGAGCCCCGGCAGCAGCAGTGG - Intergenic
984759647 4:183352570-183352592 GAGTGCCCCAGAGCCCGCAGAGG - Intergenic
984802307 4:183726373-183726395 CAGAGCACCAGCACCAGCACTGG + Intergenic
985147260 4:186906060-186906082 GAGAGTCCCAGCCCCAGCGAGGG - Intergenic
985873517 5:2577692-2577714 GAGACCCTCTGCATCAGCAGAGG - Intergenic
986310132 5:6545306-6545328 GGGTGTCCCAGCACCAGCATTGG + Intergenic
989123807 5:38031682-38031704 GACAGGGCCAACACCAGCAGGGG - Intergenic
990651063 5:57899913-57899935 GAGAGAACCATCACCAGCAATGG + Intergenic
992069614 5:73136736-73136758 AAGAGCCTCAGCCCCTGCAGAGG - Intergenic
992828209 5:80569933-80569955 GAGAGACCCAGGGCCAGCCGAGG - Intronic
994948166 5:106423251-106423273 CAGCCACCCAGCACCAGCAGAGG - Intergenic
995831640 5:116361368-116361390 GAGAGCCTCAGCGCCTGCCGCGG - Intronic
997302290 5:132814378-132814400 GAGAGCCGCCTCAGCAGCAGAGG - Exonic
998104224 5:139458013-139458035 GAGAGCTCCCGCTCCAGCTGCGG + Intronic
998146718 5:139733428-139733450 GGGAGCCGCAGCACCATCAGAGG - Intergenic
998975040 5:147636155-147636177 GAGAGATCCAGGAGCAGCAGGGG - Intronic
999536508 5:152523372-152523394 GAGAGCACCAAGAGCAGCAGAGG - Intergenic
1000964104 5:167634559-167634581 GTGAGTCCTAGCACCAGCAGTGG - Intronic
1002670572 5:180862893-180862915 GAGAGCCCCAGAGCGAGCAGAGG + Intergenic
1007165212 6:39824284-39824306 TAGAGCCCGTGCCCCAGCAGGGG + Intronic
1007728254 6:43929859-43929881 GACAGCCCCCTCACCAACAGGGG - Intergenic
1010764669 6:79765332-79765354 CAGCTGCCCAGCACCAGCAGAGG - Intergenic
1011168506 6:84478836-84478858 GAGAGCCCCAGCTGCAGAAGTGG + Intergenic
1013432119 6:110064587-110064609 GGGTGCCCCAGCCCCAGCAGGGG + Intergenic
1014236352 6:118960127-118960149 CAGATCCCCAGCGCCAGGAGTGG - Exonic
1017021463 6:150143286-150143308 GGCAGCCCCGGCTCCAGCAGCGG + Exonic
1017310742 6:152974273-152974295 GAGAGCCCTAGCACCAAAAATGG + Intronic
1017822027 6:158056506-158056528 GAGAGCAGCAGCACCTGCAAGGG - Intronic
1017869475 6:158474581-158474603 GAGAGCCAGAGCAACAGCAAGGG - Intronic
1018838291 6:167501255-167501277 GAGAGCACCAGTGCCAGCTGGGG - Intergenic
1019171200 6:170134217-170134239 GGGAGCCCCATCACATGCAGGGG + Intergenic
1019306520 7:337910-337932 GAGGGCCCCTGGACCAGCGGAGG + Intergenic
1019306537 7:337976-337998 GAGGGCCCCTGGACCAGCGGAGG + Intergenic
1019532235 7:1509524-1509546 GGGAGTCCCAGGACCAGCTGGGG - Intergenic
1019573581 7:1725293-1725315 AGGAGCCCCAGCACCAGCTGTGG - Intronic
1019639898 7:2097711-2097733 GAGACACACAGCAGCAGCAGGGG + Intronic
1019973825 7:4563902-4563924 CATCGCCCTAGCACCAGCAGGGG + Intergenic
1021416156 7:20387540-20387562 GAGAACCACACCACCAGCAGGGG - Intronic
1022172084 7:27840488-27840510 GAAAGCCCCGGCAGCAGCGGTGG + Intronic
1022795006 7:33724989-33725011 TTGAGCCCCAGAACCGGCAGCGG + Intergenic
1023659145 7:42455341-42455363 GAGAGACCCTGCACCAGCTCGGG - Intergenic
1024545353 7:50513154-50513176 GAGTGCCCCAGCTGCAGAAGCGG + Intronic
1025041674 7:55651296-55651318 CATCTCCCCAGCACCAGCAGGGG - Intergenic
1025192357 7:56905459-56905481 GAAAGCCACAGCATCAGCATTGG + Intergenic
1025679592 7:63671472-63671494 GAAAGCCACAGCATCAGCATTGG - Intergenic
1026169502 7:67941574-67941596 GAGAGCCCCTGAACCAGAATAGG - Intergenic
1026735336 7:72945455-72945477 GAGTGCCCCAGAAGCAGAAGTGG + Intronic
1026759288 7:73114370-73114392 GGAAACCCCAGCACCAGCAATGG - Intergenic
1026785676 7:73300385-73300407 GAGTGCCCCAGAAGCAGAAGTGG + Intergenic
1026875340 7:73876199-73876221 GAGACCCCCAGCCCCAGCCTTGG - Intergenic
1027088120 7:75279103-75279125 GGAAACCCCAGCACCAGCAATGG + Intergenic
1027108390 7:75419551-75419573 GAGTGCCCCAGAAGCAGAAGTGG - Intronic
1028532159 7:91849844-91849866 GAGAACCCCACCAATAGCAGGGG + Intronic
1029394227 7:100296259-100296281 GGAAACCCCAGCACCAGCAATGG + Intergenic
1029549610 7:101230715-101230737 GCCTGCCCCAGGACCAGCAGTGG + Intergenic
1029570244 7:101363766-101363788 CAGAGCCCCAGCCCCAGCCACGG - Intronic
1029694565 7:102204382-102204404 GACAGGCCCAGCACCTGGAGTGG - Exonic
1030689479 7:112517736-112517758 GACACCACCAGCAGCAGCAGTGG + Intergenic
1031395792 7:121272418-121272440 GAGAGCCCCCTCCCCACCAGTGG + Intronic
1035069451 7:156131082-156131104 GATATCCCCAGCATCAGCACAGG - Intergenic
1035108130 7:156459003-156459025 GAGAGACCCAACAGCAGCTGTGG - Intergenic
1035280765 7:157776629-157776651 GAAAGCCACAGCACCAGAGGAGG - Intronic
1035280880 7:157777051-157777073 GAAAGCCACAGCACCAGAGGAGG - Intronic
1035575093 8:699289-699311 GGGAGCGCCAGCCCCACCAGAGG + Intronic
1035729789 8:1845903-1845925 GACACCCCCAGCCCCAGCAGAGG - Intronic
1037299190 8:17433637-17433659 GAGAGCCACAGCACCTGAAGAGG + Intergenic
1038367333 8:26949061-26949083 GAGTGCCCCAGCTGCAGAAGTGG - Intergenic
1039484214 8:37898923-37898945 GAGAACACCAGCACCGGCCGAGG + Intronic
1039513800 8:38113563-38113585 GAGAGCCACAGTCACAGCAGTGG + Intronic
1039944607 8:42118607-42118629 AAGAGCTCTATCACCAGCAGTGG - Intergenic
1040596753 8:48846058-48846080 GACAGCCTCAGCACCAGCGTGGG + Intergenic
1041196817 8:55409025-55409047 AGGAGCCACAGCACCAGGAGGGG + Intronic
1044274478 8:90284202-90284224 GAGTGCCCAGGCACCAGCAGGGG - Intergenic
1045506633 8:102783230-102783252 CAGAGCACCAGCACCAGCCAAGG + Intergenic
1049231950 8:141489112-141489134 GGGAGGCCCAGGCCCAGCAGGGG - Intergenic
1049883140 9:11400-11422 CAGTGCCCCGGCGCCAGCAGGGG - Intergenic
1050728363 9:8677946-8677968 AAGAGCCTCAACACCAGCAGAGG - Intronic
1051362560 9:16294270-16294292 GAGTGCCCCAGCTGCAGAAGTGG + Intergenic
1053293365 9:36896687-36896709 CCGAGACCCAGAACCAGCAGTGG - Intronic
1054337262 9:63817920-63817942 GAGAGCCCCGGCTCCTGGAGCGG + Intergenic
1054814985 9:69466181-69466203 CAGAGGCCCAGCAGCAGGAGCGG + Intronic
1057152659 9:92808771-92808793 GAGGTCCCCAGCTCCAGCAGAGG + Intergenic
1057825234 9:98368101-98368123 GAGGGCCTCAGGACCAGCGGGGG - Intronic
1061047780 9:128176434-128176456 CGGAGCCTCAGCACCAGCAGCGG - Exonic
1061616725 9:131785261-131785283 GAGGGCTCCAGGACCAGGAGGGG - Intergenic
1061944063 9:133898727-133898749 GAGAGCCACAGCACCAGCTCAGG - Intronic
1061949228 9:133926902-133926924 GGGAGGCCCAGCACCAGCCCTGG + Intronic
1061950730 9:133934561-133934583 AAGAGTCCCAGCTCCAGGAGAGG - Intronic
1062290951 9:135794107-135794129 GAGGGCCACAGTTCCAGCAGTGG + Intergenic
1203783677 EBV:115368-115390 GAGAACCCCAGCAACATCCGGGG - Intergenic
1185890099 X:3815615-3815637 GAGAGCCGCGGCACCCGCTGCGG - Intergenic
1186917991 X:14244298-14244320 GAGAGCCCCAGCACCAGCAGTGG + Intergenic
1188263655 X:28043731-28043753 CTGAGCCCCAGCACGAACAGTGG + Intergenic
1191080517 X:56505437-56505459 GAGTGCCCCAACAGCAGAAGTGG + Intergenic
1197827050 X:130600996-130601018 GAGAGCCCTTGCACTACCAGTGG + Intergenic
1199248112 X:145630691-145630713 GAGATCCACAGCCCCCGCAGAGG - Intergenic
1199806146 X:151302391-151302413 GGGAGCCCCAGAACCAGAATAGG + Intergenic