ID: 942894542

View in Genome Browser
Species Human (GRCh38)
Location 2:181036291-181036313
Sequence AAATGCCAAGGTAATTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942894540_942894542 9 Left 942894540 2:181036259-181036281 CCACACATAAATGGTCAGTTGAT No data
Right 942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG No data
942894537_942894542 22 Left 942894537 2:181036246-181036268 CCCAGAAGTAGATCCACACATAA No data
Right 942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG No data
942894538_942894542 21 Left 942894538 2:181036247-181036269 CCAGAAGTAGATCCACACATAAA No data
Right 942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942894542 Original CRISPR AAATGCCAAGGTAATTCAGT AGG Intronic
No off target data available for this crispr