ID: 942898379

View in Genome Browser
Species Human (GRCh38)
Location 2:181085748-181085770
Sequence TAGGAGCAGCATAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942898375_942898379 -4 Left 942898375 2:181085729-181085751 CCTTTTGCACAGGTGGCCTTAGG No data
Right 942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942898379 Original CRISPR TAGGAGCAGCATAAGAAGGA AGG Intergenic
No off target data available for this crispr