ID: 942903651

View in Genome Browser
Species Human (GRCh38)
Location 2:181154793-181154815
Sequence TTCTGAAGTCCTTTAGCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942903649_942903651 26 Left 942903649 2:181154744-181154766 CCACATGAGTGCCAAACAGCTTG No data
Right 942903651 2:181154793-181154815 TTCTGAAGTCCTTTAGCGTATGG No data
942903650_942903651 15 Left 942903650 2:181154755-181154777 CCAAACAGCTTGCTCTTTTAACA No data
Right 942903651 2:181154793-181154815 TTCTGAAGTCCTTTAGCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942903651 Original CRISPR TTCTGAAGTCCTTTAGCGTA TGG Intergenic
No off target data available for this crispr