ID: 942903839

View in Genome Browser
Species Human (GRCh38)
Location 2:181157068-181157090
Sequence TCCCAATGTTGAAGGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942903839_942903843 4 Left 942903839 2:181157068-181157090 CCAGGCCTCCTTCAACATTGGGA No data
Right 942903843 2:181157095-181157117 AATTGCAATGTGAGATTTGGAGG No data
942903839_942903844 5 Left 942903839 2:181157068-181157090 CCAGGCCTCCTTCAACATTGGGA No data
Right 942903844 2:181157096-181157118 ATTGCAATGTGAGATTTGGAGGG No data
942903839_942903842 1 Left 942903839 2:181157068-181157090 CCAGGCCTCCTTCAACATTGGGA No data
Right 942903842 2:181157092-181157114 TCAAATTGCAATGTGAGATTTGG No data
942903839_942903845 6 Left 942903839 2:181157068-181157090 CCAGGCCTCCTTCAACATTGGGA No data
Right 942903845 2:181157097-181157119 TTGCAATGTGAGATTTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942903839 Original CRISPR TCCCAATGTTGAAGGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr