ID: 942905193

View in Genome Browser
Species Human (GRCh38)
Location 2:181172480-181172502
Sequence AACCTTGCACTAGTCTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942905193_942905194 19 Left 942905193 2:181172480-181172502 CCTTTCAAGACTAGTGCAAGGTT No data
Right 942905194 2:181172522-181172544 AAAATATGTTTACAAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942905193 Original CRISPR AACCTTGCACTAGTCTTGAA AGG (reversed) Intergenic
No off target data available for this crispr