ID: 942905464

View in Genome Browser
Species Human (GRCh38)
Location 2:181174946-181174968
Sequence TATGACTAGCAGTTATTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942905462_942905464 16 Left 942905462 2:181174907-181174929 CCAAGTAACTTTTGGAAGATATC No data
Right 942905464 2:181174946-181174968 TATGACTAGCAGTTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942905464 Original CRISPR TATGACTAGCAGTTATTTTC TGG Intergenic
No off target data available for this crispr