ID: 942922830

View in Genome Browser
Species Human (GRCh38)
Location 2:181397538-181397560
Sequence TGATAGGCTTAGAGCCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942922830_942922833 18 Left 942922830 2:181397538-181397560 CCACAGAGGCTCTAAGCCTATCA No data
Right 942922833 2:181397579-181397601 CAAGCCCTCTTCTTTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942922830 Original CRISPR TGATAGGCTTAGAGCCTCTG TGG (reversed) Intergenic
No off target data available for this crispr