ID: 942926537

View in Genome Browser
Species Human (GRCh38)
Location 2:181439794-181439816
Sequence TTCTTACAACTCTACACTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942926532_942926537 24 Left 942926532 2:181439747-181439769 CCCGTTGTATTTGACCTGAAAGT No data
Right 942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG No data
942926531_942926537 25 Left 942926531 2:181439746-181439768 CCCCGTTGTATTTGACCTGAAAG No data
Right 942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG No data
942926534_942926537 10 Left 942926534 2:181439761-181439783 CCTGAAAGTCACATTCACGTGTA No data
Right 942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG No data
942926533_942926537 23 Left 942926533 2:181439748-181439770 CCGTTGTATTTGACCTGAAAGTC No data
Right 942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942926537 Original CRISPR TTCTTACAACTCTACACTTT CGG Intergenic
No off target data available for this crispr