ID: 942926717

View in Genome Browser
Species Human (GRCh38)
Location 2:181441879-181441901
Sequence AAGCAAGGTCTGGGTGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942926717_942926721 -10 Left 942926717 2:181441879-181441901 CCATTTCCACCCAGACCTTGCTT No data
Right 942926721 2:181441892-181441914 GACCTTGCTTTATCTACTGCAGG No data
942926717_942926726 24 Left 942926717 2:181441879-181441901 CCATTTCCACCCAGACCTTGCTT No data
Right 942926726 2:181441926-181441948 TGCTGTTAGTCCATATCTGCTGG No data
942926717_942926722 -9 Left 942926717 2:181441879-181441901 CCATTTCCACCCAGACCTTGCTT No data
Right 942926722 2:181441893-181441915 ACCTTGCTTTATCTACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942926717 Original CRISPR AAGCAAGGTCTGGGTGGAAA TGG (reversed) Intergenic
No off target data available for this crispr