ID: 942926721

View in Genome Browser
Species Human (GRCh38)
Location 2:181441892-181441914
Sequence GACCTTGCTTTATCTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942926717_942926721 -10 Left 942926717 2:181441879-181441901 CCATTTCCACCCAGACCTTGCTT No data
Right 942926721 2:181441892-181441914 GACCTTGCTTTATCTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942926721 Original CRISPR GACCTTGCTTTATCTACTGC AGG Intergenic
No off target data available for this crispr