ID: 942927069

View in Genome Browser
Species Human (GRCh38)
Location 2:181446613-181446635
Sequence GAATCACTTTAACCCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942927067_942927069 -10 Left 942927067 2:181446600-181446622 CCAACTACTCAGAGAATCACTTT No data
Right 942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG No data
942927066_942927069 -1 Left 942927066 2:181446591-181446613 CCTGTAGTTCCAACTACTCAGAG No data
Right 942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942927069 Original CRISPR GAATCACTTTAACCCAGGCT TGG Intergenic
No off target data available for this crispr