ID: 942927987

View in Genome Browser
Species Human (GRCh38)
Location 2:181456837-181456859
Sequence AGGAAGGAAGTGGGTATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 928}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942927980_942927987 1 Left 942927980 2:181456813-181456835 CCGGGCTGCAGAGGAAGTGTGGG 0: 1
1: 1
2: 2
3: 52
4: 384
Right 942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG 0: 1
1: 0
2: 3
3: 55
4: 928
942927978_942927987 2 Left 942927978 2:181456812-181456834 CCCGGGCTGCAGAGGAAGTGTGG 0: 1
1: 0
2: 4
3: 44
4: 378
Right 942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG 0: 1
1: 0
2: 3
3: 55
4: 928
942927975_942927987 19 Left 942927975 2:181456795-181456817 CCTGCTCACGCATGCAGCCCGGG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG 0: 1
1: 0
2: 3
3: 55
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942927987 Original CRISPR AGGAAGGAAGTGGGTATAGA AGG Intergenic
900863113 1:5246601-5246623 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
900926620 1:5710099-5710121 AGGAAGGAAGTGGGAGGAGTGGG - Intergenic
901526790 1:9828231-9828253 AGGAAGGAAGTGGACAGAAATGG - Intergenic
901741943 1:11347581-11347603 AGGAAGGAAGGAAGGATAGAAGG - Intergenic
902620588 1:17648521-17648543 AGGAAGGAGGTGGGTAGAGCTGG - Intronic
902692764 1:18120359-18120381 AGGCAGGAAGAGGGTAAAGTTGG - Intronic
902827755 1:18988728-18988750 AGGAAGGAAGGGGGGAAGGAAGG + Intergenic
903258147 1:22116494-22116516 AGGCAGGGAGAGGGGATAGAGGG - Intergenic
903331710 1:22600051-22600073 AGGAAGGAAGGGGGGATGGAGGG + Intronic
905223650 1:36465925-36465947 AGGAAGGAAGGGGGGAAGGAAGG + Intergenic
905323142 1:37131804-37131826 AGGAAGGAAGTGGGGAAGGAAGG - Intergenic
905515757 1:38560692-38560714 AAGAAGGAAGGGGCTATAGCGGG + Intergenic
905824753 1:41019490-41019512 AGGAAGGAAGTTGGGCCAGAAGG - Intronic
906105745 1:43291087-43291109 AAGGGGGAAGTGGGTACAGAGGG + Intergenic
906782676 1:48586469-48586491 AGGGAGGAGGAGGGCATAGAAGG + Intronic
906844364 1:49175232-49175254 AGGAGGGAAATGGGCATATAAGG + Intronic
907200796 1:52725503-52725525 AGGAAGAAAGTGAGTACATAAGG + Intergenic
907233729 1:53025502-53025524 AGGAATGTAGTGGGAATAGAGGG - Intronic
907268979 1:53279540-53279562 AGGAAGCATCTGGGTATGGAGGG - Intronic
907437397 1:54458666-54458688 AGGAAGGAAGTGAGGAGGGAGGG + Intergenic
907462280 1:54612098-54612120 TGGAAGGTAGGGGGTATAGTGGG + Intronic
907615749 1:55924540-55924562 AGCAAGGAAGTAGGTATGGCTGG + Intergenic
907760630 1:57355331-57355353 AGGAAGGAAGGGAGGATGGAAGG - Intronic
908035420 1:60046324-60046346 AGGAAGGAAGGAGGGAGAGAGGG - Intronic
908773413 1:67616600-67616622 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
909112311 1:71494740-71494762 AGGAAGGAAGTGGGTCTGTGTGG - Intronic
909526910 1:76635171-76635193 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
909786361 1:79618900-79618922 AGGAAGAAAGTGGAGAAAGATGG - Intergenic
910006824 1:82407267-82407289 AATAAGGTAGTGGGAATAGAGGG + Intergenic
910051315 1:82977549-82977571 AGGAAGGAAGTAGGGAAGGAAGG - Intergenic
910088345 1:83431297-83431319 AGGAGGGAAGTGGGTCTGGCAGG - Intergenic
910229077 1:84967860-84967882 AGGAAGGAAGAAGGGAGAGAAGG + Intronic
911195068 1:94986346-94986368 AAGAAGCAAGGGAGTATAGAAGG + Intronic
911454690 1:98108472-98108494 AGTAAGGAAGAGGGAATAGATGG + Intergenic
912213087 1:107576545-107576567 AGGAAAGAAGTGGGTGAAAATGG - Intronic
912623460 1:111188817-111188839 AGGAAGGAAGTGTGGAGTGAAGG + Intronic
912735577 1:112146948-112146970 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
913010428 1:114677789-114677811 AGGAAGGAAGGAGGGAGAGAGGG - Intronic
913013954 1:114713947-114713969 AGAAAACAAGTGGTTATAGATGG - Exonic
913587351 1:120288553-120288575 AAGAACAAAGTGGGTATGGATGG + Intergenic
913620834 1:120609816-120609838 AAGAACAAAGTGGGTATGGATGG - Intergenic
913998244 1:143669222-143669244 AGAAAGGAAGTGATTAAAGAAGG + Intergenic
914569366 1:148900436-148900458 AAGAACAAAGTGGGTATGGATGG + Intronic
914603460 1:149229820-149229842 AAGAACAAAGTGGGTATGGATGG - Intergenic
915289912 1:154876630-154876652 AGGAAAGAAGTGTGGACAGAAGG - Intergenic
915293285 1:154900843-154900865 AGGAAAGAACTGGGCATAGAGGG + Intergenic
915315208 1:155024662-155024684 AGGTAGGTAGTGGGTGCAGAGGG - Intronic
915527868 1:156487304-156487326 TGGTAGGGAGTGGGGATAGATGG - Intronic
915590311 1:156866749-156866771 TGGAAGGCAGTGTGTGTAGATGG - Intronic
916247440 1:162703417-162703439 AGGGAGGAAGAGAGGATAGATGG + Intronic
916260810 1:162840227-162840249 AGGAAGGAAGGGGGGAGGGAGGG + Intronic
916434099 1:164760459-164760481 AGGAAGGAAGGAGGGAAAGAAGG - Intronic
916446951 1:164881315-164881337 AGGAAGGAAGGAGGAAAAGAAGG + Intronic
916446959 1:164881351-164881373 AGGAAGGAAGGAGGAAAAGAAGG + Intronic
916446967 1:164881387-164881409 AGGAAGGAAGGAGGAAAAGAAGG + Intronic
916958910 1:169869259-169869281 AGGAAATGAGAGGGTATAGAAGG - Intronic
916987107 1:170203208-170203230 AGGCAGGGAATGGGTAGAGATGG + Intergenic
918209097 1:182335049-182335071 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
918352816 1:183675328-183675350 AGGAAGGAAGGAAGGATAGAGGG - Intronic
918440226 1:184559494-184559516 AGGAAGGAAGGGGGGAAGGAAGG - Intronic
918707776 1:187689513-187689535 AGGAAAGTAATGGATATAGAAGG + Intergenic
919333048 1:196195382-196195404 AGGAAGGAAGGGGGGAAGGAAGG + Intergenic
919392972 1:197010573-197010595 AGGAAGGAAGCAGGGAAAGAAGG + Intergenic
919493510 1:198235377-198235399 AGGAAGAAAGGGGGAAAAGAAGG - Intronic
919844869 1:201635700-201635722 AGGTAGGTATTGGGTATAGGGGG - Intronic
920046478 1:203136096-203136118 AGGAAGGAAGTGGAGAGACACGG + Intronic
920963903 1:210686554-210686576 AGGAAGGAAGGTGGAATGGAGGG + Intronic
921285064 1:213602208-213602230 AGGAAGGAAGAAGGAATGGAGGG - Intergenic
921562187 1:216672052-216672074 AGGAAGGAAGGAGGGAAAGAAGG + Intronic
921833980 1:219759239-219759261 AGGAAGGAAGTGTGGATAGAAGG + Intronic
922051101 1:221991392-221991414 GGGTAGGAAGTGGGTGTGGAAGG + Intergenic
922343969 1:224680842-224680864 AGAAAGGAAGAGGCTGTAGATGG - Intronic
922412492 1:225390030-225390052 GGGAAGGAAGTGGGTTGGGAGGG - Intronic
922828334 1:228537173-228537195 AGAAAGAAAGTGGGTCTAGGGGG - Intergenic
923004189 1:230032137-230032159 AGGAAGGGAGTGGTTGTGGAAGG + Intergenic
923127732 1:231047195-231047217 AGGGAGGAAGGGGTTATGGAGGG - Intergenic
923261005 1:232268061-232268083 AGGAAGGAAGGAAGGATAGAAGG - Intergenic
923268512 1:232334724-232334746 AGGGAGGAAGATGGTAGAGAAGG - Intergenic
923784466 1:237054196-237054218 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
924419894 1:243898050-243898072 AGGAGGGTAGTGGGTATGGCAGG + Intergenic
924573794 1:245261078-245261100 AGGAAGGAAGCAGGGAGAGAGGG - Intronic
924746824 1:246843031-246843053 ACAAAGGGAGTGGGTACAGAAGG - Intronic
1062968959 10:1631235-1631257 AGGAAGGAAGAAAGTAAAGAAGG - Intronic
1063025949 10:2178863-2178885 AGGAAGGAAGGGAGGATTGAAGG - Intergenic
1063156317 10:3382284-3382306 AGGAAGGAAGGAGGGAGAGAAGG + Intergenic
1063193331 10:3718073-3718095 AGGAGGGAAGTGGGGAGGGAGGG + Intergenic
1063198004 10:3760857-3760879 AGGAAGGAAGGAAGTAGAGAGGG - Intergenic
1063534180 10:6866911-6866933 AGGAAGGAAGTGAGGAAAGGAGG - Intergenic
1063605725 10:7521338-7521360 AGGAAGGAAGAAGGTTCAGAGGG - Intergenic
1063690200 10:8280034-8280056 AGGAAGGAAGAAAGGATAGAAGG + Intergenic
1063697977 10:8356344-8356366 AGGAAGGAAGGAGGGAGAGAAGG - Intergenic
1063907061 10:10792025-10792047 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
1064332852 10:14410016-14410038 AGGAAGGAAGTGGGGGAGGAAGG + Intronic
1064332860 10:14410040-14410062 AGGAAGGAAGTGGGGGAGGAAGG + Intronic
1064929289 10:20605879-20605901 AGGAAGGAAATGGGAAAAAATGG + Intergenic
1065011351 10:21423590-21423612 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
1065455414 10:25901843-25901865 AGGAAGGGAGTGGGTAAGGAAGG - Intergenic
1065497251 10:26341958-26341980 AGGAAGGAAGGGGGGAAGGAAGG + Intergenic
1065746658 10:28848472-28848494 AGGAAGGAACTGGATTTTGAAGG + Intronic
1065791328 10:29263342-29263364 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
1066010929 10:31192813-31192835 AGGAAGGAAGGAGGAAAAGAAGG - Intergenic
1066209170 10:33220028-33220050 AGGCAGGAATTGGGTGGAGAAGG - Intronic
1066482265 10:35808482-35808504 AGGAAGAAAGCAGCTATAGATGG + Intergenic
1067280603 10:44869352-44869374 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1067280645 10:44869483-44869505 AGGAAGGAAGGAGGTAGAAAGGG + Intergenic
1068510888 10:57964250-57964272 CTGAAGGAATTAGGTATAGAGGG - Intergenic
1068655704 10:59573946-59573968 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1068775266 10:60862087-60862109 AGGAAGGAAGAAGGGAAAGAAGG - Intergenic
1068830731 10:61491630-61491652 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1069237062 10:66089394-66089416 AGGAAGGAAGGGAGTAAGGAAGG - Intronic
1069642359 10:69964084-69964106 TGGAAGGAAGAGGGTAGAGAGGG + Intronic
1069685160 10:70313209-70313231 AGGAAGGAGGAGGGTGCAGAGGG - Intronic
1069998296 10:72356894-72356916 ACCAAGGAAGTGAGTGTAGATGG + Intergenic
1070460930 10:76669338-76669360 ATGATGGAAGTGTGAATAGAAGG + Intergenic
1070702421 10:78613428-78613450 AGGAAGGAAGGAGGGAGAGAAGG + Intergenic
1070743644 10:78919381-78919403 AGGGAGTAAGTGGGGATGGAAGG + Intergenic
1071156826 10:82699331-82699353 AGGAAGGAAGAAGGGATGGAGGG + Intronic
1071218049 10:83430560-83430582 AGGAAAAAAGTGGGTATTAAGGG + Intergenic
1071444771 10:85735799-85735821 AGGAAGGAAGGAGGGATGGAGGG + Intronic
1071791362 10:88957760-88957782 AAAAAAGAAGTGGGTAGAGAGGG - Intronic
1071827087 10:89336119-89336141 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1071827107 10:89336180-89336202 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1073752586 10:106545974-106545996 TGGAAGGAAGTGGTGACAGAAGG - Intergenic
1073888567 10:108070209-108070231 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1073988817 10:109240579-109240601 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1074204655 10:111272264-111272286 AAGAGGGAAGTGGGGAGAGAGGG + Intergenic
1074410447 10:113223639-113223661 GAGAAGGAAGTGATTATAGATGG + Intergenic
1074919889 10:117997219-117997241 AGGAAGGATGTATGTATGGATGG + Intergenic
1075122708 10:119675892-119675914 AGGAAGGAAGGGGGGAAGGAAGG - Intronic
1075559512 10:123458413-123458435 AGGAAGGAAGGGAGGAGAGATGG - Intergenic
1075686330 10:124367605-124367627 GGGAAGGAGGTGGGCATGGAGGG - Intergenic
1075686351 10:124367659-124367681 GGGAAGGAGGTGGGCATGGAGGG - Intergenic
1075863485 10:125697460-125697482 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
1076934756 10:133559898-133559920 AAGAAGCAAAAGGGTATAGAAGG - Intronic
1077362568 11:2147222-2147244 GGGCAGAAAGTGGGTAGAGAGGG - Intronic
1077591184 11:3492107-3492129 AGGAAAGGAGAGGGAATAGATGG + Intergenic
1077782583 11:5347760-5347782 AGGAAGGAGGTAGGGAGAGAGGG + Intronic
1078179132 11:8995860-8995882 AGCAAGGAAGTGAGTGTGGATGG - Intronic
1079352327 11:19702209-19702231 TGGAAGGAAGGGAGAATAGACGG + Intronic
1079392873 11:20037264-20037286 AGAAAGGAAGAGGTTATGGAAGG - Intronic
1079587077 11:22139440-22139462 AAGAAGGAAGTAGGAAGAGAGGG - Intergenic
1079607513 11:22388670-22388692 AGGAAGGGAATGGGTCTAGAGGG + Intergenic
1079629234 11:22653096-22653118 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1079668701 11:23138806-23138828 AGGAAGAAAGTAGGTTCAGAGGG - Intergenic
1080376997 11:31724232-31724254 AGGAAGGATGTGGGAAGAAAGGG + Intronic
1080724125 11:34878194-34878216 AGGAAGGAATTGGGAAGAGTAGG - Intronic
1081693619 11:45094661-45094683 AGGAAGGAAGGAGGGATGGAAGG + Intergenic
1081800982 11:45859168-45859190 AGGATGGAAGTGGGAATATGAGG - Intronic
1081838793 11:46179814-46179836 AGGAAGGGTGTGATTATAGAAGG - Intergenic
1082763622 11:57149364-57149386 AGGAAGGAAGAGGGGAAGGAAGG + Intergenic
1083353711 11:62049326-62049348 AGGAAGGAAGGAGGTATGGAAGG + Intergenic
1083539645 11:63503655-63503677 AGGAAGGAAGTGAGGCTGGATGG + Intergenic
1083629365 11:64087860-64087882 ATGAAGGCAGTGGGTACACAGGG + Intronic
1083911294 11:65711847-65711869 AGAAAGGAAGTGGCCTTAGAAGG - Intergenic
1083917153 11:65754996-65755018 AGGAAGAAAGGTGGTAAAGATGG - Intergenic
1084264738 11:67999079-67999101 AGAAAGAAAGTGGGACTAGAGGG + Intronic
1084356861 11:68644702-68644724 AGGAAGGAAGTAAGGAAAGAAGG + Intergenic
1084440196 11:69168282-69168304 AGGGAGGGAGAGGGTAGAGAGGG + Intergenic
1085122721 11:73977594-73977616 GGGAAGGCAGTGGGTAGAGTGGG - Intronic
1085370745 11:76002594-76002616 ATGAAGTATGTGGGGATAGAGGG + Intronic
1085580273 11:77644273-77644295 AGGAAGGAAGGAGGGATGGAGGG - Intergenic
1085698828 11:78728564-78728586 AGGAAGGAAGTGGGGAAGGAAGG - Intronic
1085713206 11:78848838-78848860 AGGAAGGAAGGAGGAATAGAAGG + Intronic
1086041368 11:82483215-82483237 AGGAAGGAAGTGATTTTATATGG - Intergenic
1086480750 11:87235280-87235302 AGGAAGGAAGGAGGGAAAGAGGG + Intronic
1086518718 11:87645989-87646011 AGGAAGGAAGGGGGAAGGGAAGG - Intergenic
1087520113 11:99222309-99222331 AGGAAGGAAGTAGGGAAGGAAGG + Intronic
1088001654 11:104889101-104889123 AGGAAGGAAGGGAGTAAGGAAGG + Intergenic
1088487493 11:110354897-110354919 AGGAAGGAAGAAAGTAAAGAAGG - Intergenic
1088843206 11:113643950-113643972 AGGAAGCAAGAGGGAAGAGAGGG + Intergenic
1089219289 11:116857646-116857668 ATGTAGGAAGTGGGTATTGGTGG - Intronic
1090001211 11:122960452-122960474 AGGAAGGAAGAGGTGGTAGAGGG - Intergenic
1090089438 11:123681808-123681830 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1090260442 11:125315162-125315184 AGGAAGGAGGTGGGGAGAGGGGG - Intronic
1090508035 11:127340554-127340576 TGGAAGGAAGTGGCTATGGTGGG + Intergenic
1090531053 11:127591880-127591902 AGGAAGGAAAGGGGAAGAGAAGG + Intergenic
1090531064 11:127591937-127591959 AGGAAGGAAAGGGGAAGAGAAGG + Intergenic
1090531075 11:127591994-127592016 AGGAAGGAAAGGGGAAGAGAAGG + Intergenic
1090853769 11:130593840-130593862 AGGAAGGAAGTTTGGGTAGAAGG + Intergenic
1091154414 11:133360578-133360600 AGGAAGGAAGCGGGGACGGAGGG + Intronic
1091327743 11:134703879-134703901 AGGAAGGATGATGGTATAAAAGG + Intergenic
1091616771 12:2055494-2055516 AGTAAGGAAATGGGTTCAGAAGG - Intronic
1091626040 12:2121775-2121797 AGGAAGGAGGTGGCTACACAGGG - Intronic
1091982130 12:4874183-4874205 AGGAAGGAAGAAGGTTTGGAAGG + Intergenic
1092262306 12:6959267-6959289 AGGAAGGAAGTGGGTGTGGGGGG + Intronic
1092285787 12:7128647-7128669 AGGAAGGAAGAGGGGAGAAAGGG + Intronic
1092290821 12:7158601-7158623 AGGAAGGAAGTTGGAAAGGAGGG - Exonic
1093228264 12:16512217-16512239 GTGAAGGATGTGGGTATGGATGG + Intronic
1093643380 12:21554197-21554219 AGGAAGGAAGTGAGCAAGGAAGG + Intronic
1093908011 12:24714631-24714653 AGGAAGGAAGGGCGGATGGAAGG + Intergenic
1094080132 12:26525734-26525756 AGGAAGGAACAGGGCATAGTAGG - Intronic
1094545080 12:31397204-31397226 AGGAAGAAAGTTGGGACAGAAGG + Intronic
1095417858 12:41995371-41995393 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1096293298 12:50361090-50361112 AGGAAGAAACTTGGAATAGAAGG + Intronic
1096522582 12:52192509-52192531 AGGAAGGGAGAGGGGGTAGAAGG - Intergenic
1096553484 12:52389508-52389530 AGGAAGGAGGCGGGTGTGGATGG - Intergenic
1096613119 12:52816071-52816093 AGGGAGGAAGTGGCTGGAGAAGG - Intergenic
1096696946 12:53355324-53355346 AGGAAGGCAGTGGGGAGGGAGGG + Intergenic
1096709057 12:53442192-53442214 AGGAACCAAGTAGGTATTGAGGG + Intronic
1096842968 12:54390498-54390520 AAGAAGGAAGTGAGGAAAGAGGG + Intronic
1096907947 12:54953018-54953040 CTGAAGGCAGTGGGAATAGAGGG - Intronic
1097302033 12:58029208-58029230 ATGAAGGAAGAGGGAAGAGAAGG - Intergenic
1097644600 12:62221204-62221226 AGGAAGGAAGGGGGGAAGGAAGG + Intronic
1097874509 12:64631144-64631166 AGGTAAGAAGTGGGCAGAGAAGG + Intronic
1098799376 12:74934559-74934581 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
1099338159 12:81391914-81391936 AGGGTGGGAGTGGATATAGATGG + Intronic
1099608831 12:84839312-84839334 AGGAAGGAGGTTGATACAGAAGG - Intergenic
1100209015 12:92381907-92381929 AGGAAGGGAGGGGGGATGGAGGG + Intergenic
1100209028 12:92381934-92381956 AGGAAGGGAGGGGGGATGGAGGG + Intergenic
1100556169 12:95696010-95696032 AGGAAGGAAGTGAGTATGGGAGG - Intronic
1100798758 12:98209722-98209744 AGGAAGGAAGTAAGTAAGGAAGG + Intergenic
1101245263 12:102878627-102878649 GGGAAGGAAGAGGGAAGAGAGGG + Intronic
1101255529 12:102973495-102973517 AGGAAGGAAGGGGGGAGGGAGGG - Intergenic
1101570938 12:105953166-105953188 AGGATGGAAAGGGGTATAGCAGG + Intergenic
1101573587 12:105977601-105977623 AGGATGGAAGTAGGCATAGAAGG - Intergenic
1101803038 12:108039198-108039220 AGGAAGAAAGTGTGTAAATAGGG + Intergenic
1101952677 12:109188556-109188578 AGGAAGGAATTGGGAAAAGGAGG - Intronic
1102389463 12:112537823-112537845 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1102544159 12:113642653-113642675 AGGAAGGAAGGAGGGATGGAGGG - Intergenic
1102552560 12:113702263-113702285 AGGAAGGAAGGGAGGAAAGATGG - Intergenic
1102691629 12:114765914-114765936 AGGAGGGAAGTGGGTAAGAAGGG - Intergenic
1102992113 12:117322737-117322759 GGGAAGGAAGTGGGGAGGGAAGG - Intronic
1104191081 12:126482452-126482474 AGGGAGGAAGTGGGGAAGGAGGG - Intergenic
1104396423 12:128437521-128437543 AGGAAGGAAGGGGGCAAAGATGG + Intronic
1104582889 12:130023692-130023714 AGGAAGGGAGGGGGGAGAGATGG + Intergenic
1105606591 13:21931021-21931043 AGGAAGGAAGCGGGAAGGGACGG + Intergenic
1105957273 13:25295735-25295757 AGGAAGAAAGTGGGCCAAGACGG - Intergenic
1106131528 13:26943579-26943601 AGGAAGGAGGCAGGAATAGAGGG + Intergenic
1106211813 13:27655848-27655870 AGGAAGGAAGGGAGTGGAGAAGG + Intronic
1106288060 13:28335388-28335410 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1106568827 13:30908693-30908715 GGGAAGGAAGTGGGGAGGGAGGG - Intronic
1107285225 13:38782895-38782917 GGAAAAGAAGTGGGTATAAAGGG - Intronic
1107716547 13:43205306-43205328 AGGAAGGAAGTGGGGAGAGAAGG - Intergenic
1107798906 13:44084825-44084847 AGGATGCAAGTGGGTAGAGAAGG - Intergenic
1108090984 13:46849509-46849531 AGGAAGGGAGTGAGAAGAGAGGG - Intronic
1108578241 13:51807345-51807367 AGGTAGGAAGTTGGTTCAGATGG - Intergenic
1109181589 13:59220106-59220128 AGGAAGGAAGGAAGGATAGAAGG + Intergenic
1110212447 13:72989402-72989424 AGGAAGGAAGTACTGATAGATGG + Intronic
1110325775 13:74213630-74213652 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1110950525 13:81483785-81483807 AGGAAGAAAGTGATTATCGAGGG - Intergenic
1111955080 13:94747789-94747811 AGGAAGGAAGGGGGGAAATAAGG + Intergenic
1112001997 13:95219364-95219386 AGCCAGGGAGTGGGTAAAGAAGG + Intronic
1112271741 13:97976000-97976022 ACGTAGGAAGTGGGTCTAAAGGG + Intronic
1112357087 13:98682583-98682605 AGAAAGGAAGTGTGTCCAGAGGG + Intergenic
1112728714 13:102335019-102335041 TTGATGGAAGAGGGTATAGACGG - Intronic
1112742060 13:102486277-102486299 AAGGAGGAAGTGGGTAATGATGG + Intergenic
1113673974 13:112195796-112195818 AGGAAGGAAGAGGGGAAGGAGGG - Intergenic
1116574152 14:46551757-46551779 AGGAAGCCAGTGGTTAGAGAGGG - Intergenic
1116933304 14:50711995-50712017 ATGCAGGAAGTGGGTAGAGTTGG + Intergenic
1116992573 14:51291885-51291907 AGGAGGGAAGGGGGCAGAGATGG - Intergenic
1117059577 14:51948278-51948300 AGAAAGGAAGAGGGATTAGAAGG + Intronic
1117325424 14:54664566-54664588 GAGAAGGAAGTGGGGAGAGAGGG - Intronic
1117449047 14:55833072-55833094 AGGAAGGAAGTGGGAAAGAAAGG + Intergenic
1117530472 14:56655949-56655971 TGGAAGGATGTGGGTCTGGAGGG + Intronic
1117645355 14:57845866-57845888 AGGAAAGAAGTGAGAAGAGAAGG - Intronic
1117783364 14:59257717-59257739 AGGAAGGAAGAGGCTGAAGATGG - Intronic
1117891662 14:60428371-60428393 AGGTAGGAGGTGGGGATAAAGGG - Intronic
1118391204 14:65297349-65297371 AGGAAGGAAGAGGTCAGAGAAGG - Intergenic
1118406352 14:65427650-65427672 AAGAAGGAATTCGGTATATAAGG - Intronic
1118816667 14:69318950-69318972 AGGAAGGAAGGAGGGAGAGAGGG - Intronic
1119170132 14:72528662-72528684 AGGAAGGAAGTGGGAAAGGAGGG + Intronic
1119860924 14:77935527-77935549 AGGAAGTAGATGGGTAAAGAAGG + Intergenic
1120126949 14:80755381-80755403 AGGAAGGAAGAGGGTTGAGATGG - Intronic
1120431693 14:84426296-84426318 AGGAAGGAAGGAGGGAAAGAGGG - Intergenic
1121882587 14:97514323-97514345 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
1121904476 14:97727169-97727191 AGTAAGCAAGTGGGTAAATACGG - Intergenic
1122102305 14:99422806-99422828 AGGAGGGAAGTGGGGATGCAGGG + Intronic
1122120582 14:99551472-99551494 AGTGAGCAAGTGGGTGTAGAAGG + Intronic
1123678643 15:22739485-22739507 AGGAAGGAAGGGGGAAGGGAAGG - Intergenic
1123704386 15:22940457-22940479 AGGCAGAAAGTGGGGAAAGATGG - Intronic
1123899361 15:24860929-24860951 ATGAAGGAAATGGGTATAATAGG - Intronic
1124106791 15:26745608-26745630 AGGAGGGGTGTGGGTAAAGAAGG - Intronic
1124330849 15:28813766-28813788 AGGAAGGAAGGGGGAAGGGAAGG - Intergenic
1125487939 15:40125256-40125278 AGGAAGGAAATGGATACAGGTGG + Intergenic
1125582124 15:40793595-40793617 AGGAATGGAGTGAGTAAAGAAGG + Intronic
1125719949 15:41840454-41840476 TGGAAGGAAGTGGGTCTGGGCGG + Intronic
1126371436 15:47951215-47951237 AGGAAGGAAGGAGGGAGAGAAGG + Intergenic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126725607 15:51628586-51628608 AGGAAGGAAGAAGGCATAAAAGG - Intergenic
1126897529 15:53275021-53275043 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1126923483 15:53554701-53554723 AGAAAGGAAGTGAGTTTACAGGG + Intronic
1127064517 15:55222810-55222832 AGGAAGCAAGTGGGTTGAGAAGG - Intronic
1127093210 15:55486887-55486909 AGGAAGGAAGCCAGTAAAGAGGG - Intronic
1127117023 15:55738890-55738912 AGGAAGGAAGGGGGAAGGGAAGG + Intronic
1127117035 15:55738924-55738946 AGGAAGGAAGTAGGAAGGGAGGG + Intronic
1127507496 15:59610689-59610711 AGGAAGGAAGGAGGGAAAGAGGG - Intronic
1127617756 15:60703892-60703914 GGGAAGGAAGAAGGTCTAGAAGG + Intronic
1127920901 15:63493395-63493417 AGGGAGGAAGAGGGTAGGGAAGG + Intergenic
1128371262 15:67041155-67041177 AGGAAGGAAAAGGGGAGAGAAGG + Intergenic
1128394032 15:67205352-67205374 ATGTAGGAAGTTGGTATATAGGG + Intronic
1128988853 15:72241732-72241754 AGGATGGGAATGGGTATAGATGG - Intronic
1129384088 15:75185971-75185993 AAGAAGGAAGTGGGGAGGGAGGG + Intergenic
1129933016 15:79428156-79428178 AGGAAGGAAGGAGGGAGAGAAGG - Intergenic
1130636970 15:85631732-85631754 AGGAAGGGAGTGGGGATAAACGG + Intronic
1130801588 15:87269513-87269535 ATGACAGTAGTGGGTATAGAAGG - Intergenic
1130853133 15:87817651-87817673 ATCAAGCAAGTGGTTATAGAAGG + Intergenic
1130906723 15:88245968-88245990 AATAAGGAAGTGGGGAAAGATGG + Intronic
1131288279 15:91081238-91081260 AGGAAGGAAGTAGGGAAGGAGGG - Intergenic
1131313086 15:91308276-91308298 AGGAAGGAGGTGAGGATGGAGGG + Intergenic
1131449319 15:92525994-92526016 AGGAAGGAAGGAGGGATGGAGGG - Intergenic
1131937773 15:97525751-97525773 AGGAAAGAAGAAGGGATAGAAGG + Intergenic
1133204756 16:4226644-4226666 AGGAAGGAAGGGTGAATGGAAGG + Intronic
1133572283 16:7053286-7053308 TGGAGGAAAGTGGGTAGAGAGGG - Intronic
1133593113 16:7265356-7265378 AGGAAAGAAGTGGGTGTGGAGGG + Intronic
1133663055 16:7937521-7937543 AGGAAGGAAGTGGGGAGGAAGGG - Intergenic
1133862045 16:9605251-9605273 AGGAAGGAAGGGGGAAAGGAAGG - Intergenic
1134230230 16:12423324-12423346 CGGGAGGCAGTGGGTAGAGACGG - Intronic
1134340630 16:13342035-13342057 AGGGAGGAAGTGGGTAGATTTGG - Intergenic
1134419068 16:14069922-14069944 ATGGAGGAAGTGGGTGAAGAAGG - Intergenic
1134637054 16:15800445-15800467 AGGAGGGAAGGGTGTGTAGATGG + Intronic
1135096058 16:19565716-19565738 AGGAAGGAAGGGAGTAAAAATGG - Intronic
1135476431 16:22780115-22780137 AGGAAGGAAGGGAGGAGAGAAGG + Intergenic
1135826120 16:25730440-25730462 AGGAAGGAAGAAGGGAGAGAGGG - Intronic
1135826173 16:25730684-25730706 AGGAAGGAAGAAGGGAGAGAGGG - Intronic
1135908490 16:26537587-26537609 AGGAAGAAAGTGAGAAAAGAAGG - Intergenic
1135921965 16:26658686-26658708 AGGATGCACGTGGCTATAGAGGG - Intergenic
1135927710 16:26709891-26709913 AGGAAGGAAGGGTGTTAAGAAGG + Intergenic
1136537770 16:30910484-30910506 AGGAAGGAAATGGGTAGGGAAGG + Intergenic
1136795888 16:33019170-33019192 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
1136874033 16:33835228-33835250 AGGAAGGAAGGAAGTAAAGAAGG - Intergenic
1137708794 16:50552449-50552471 AGGAAGGAAGAGGGCAAACAGGG - Intronic
1137842567 16:51653648-51653670 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
1137977086 16:53041131-53041153 AGGAAGGAAGGAGGCATGGATGG + Intergenic
1138022883 16:53500803-53500825 GAAAAGGAGGTGGGTATAGAAGG - Intronic
1138195835 16:55051512-55051534 GGGAAGGAAGTGGGGAGGGAAGG + Intergenic
1138653872 16:58478901-58478923 AGGAAGGATATGGGTTTAGAAGG - Intronic
1139119496 16:63998374-63998396 AGGAAGACAGTGGGTTTGGAAGG - Intergenic
1139657913 16:68400148-68400170 AGGCAGGAAGTGGGACTAGGAGG - Intronic
1140465351 16:75176772-75176794 AGGGAGGAAGTGGGGAGGGAAGG + Intergenic
1140700331 16:77575379-77575401 AGGAAGGAAGGGGGTAATGACGG - Intergenic
1140828605 16:78730323-78730345 AGGAAGGAAATGGGAAGAAAAGG - Intronic
1141167291 16:81669126-81669148 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141167331 16:81669312-81669334 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141167353 16:81669403-81669425 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141314940 16:82952928-82952950 AGGACGGAGCAGGGTATAGAAGG + Intronic
1141668488 16:85479007-85479029 AGGAAGGAAGGAGGTAGGGAGGG - Intergenic
1141756781 16:85996739-85996761 AGGAAGGAAGGAGGGATGGAGGG + Intergenic
1141894867 16:86953019-86953041 AGAAAGGAAGTGGGCAGAGGGGG - Intergenic
1203098146 16_KI270728v1_random:1280828-1280850 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
1203143439 16_KI270728v1_random:1783899-1783921 AGGAAGGAAGGGGGGAAGGATGG - Intergenic
1143356681 17:6334859-6334881 AGGAAGGAAGTGGGGAAGGAAGG + Intergenic
1143544500 17:7588444-7588466 GGGCAGGTAGTGGGTATAGGTGG + Exonic
1143701087 17:8660788-8660810 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1143934969 17:10474172-10474194 AGGAAGGAAGTGAGAATATGAGG + Intergenic
1144325439 17:14175103-14175125 AGGAGGGAATTGGCTATAGAGGG + Intronic
1144444482 17:15314462-15314484 GGGATGGAAGTGGGTAGAGCAGG + Intronic
1144474308 17:15571989-15572011 AGGAGGGAATTGGCTACAGAGGG + Exonic
1144605532 17:16662390-16662412 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1145079074 17:19879680-19879702 AGGAAGCAAGGGGGAAAAGAGGG - Intergenic
1145416488 17:22717485-22717507 AGGAAGGAACTGGGGAGTGAGGG - Intergenic
1146023072 17:29295133-29295155 AGGAAGGAAGAGGGTTGTGATGG + Intergenic
1146093059 17:29901683-29901705 AGGAAGGGAGTGGGGAAGGAAGG - Intronic
1146416324 17:32636632-32636654 GGCAAGGAAGTGGGGAGAGAAGG + Intronic
1146511319 17:33451431-33451453 AGGGAGGAAGGGGTCATAGAAGG - Intronic
1147500295 17:40956599-40956621 AGAAAGGAAGAAGGTATTGATGG + Intergenic
1147522346 17:41186355-41186377 AGGAGGGAAGAGGGGATGGAAGG + Intergenic
1147979578 17:44266280-44266302 AGGAAGAAAGTGAATAAAGATGG - Intronic
1148073600 17:44922617-44922639 AGCAAGGAGGTGGGCATAAAAGG + Intergenic
1148467517 17:47873815-47873837 AGGAAGGAAGGGGGGAGGGAGGG - Intergenic
1148488196 17:48004865-48004887 GGGAGGGAGGTGGGTAGAGAAGG + Intergenic
1149206049 17:54249826-54249848 GGGATGGAAGTGGGGGTAGAAGG + Intergenic
1149345959 17:55735954-55735976 AGGAAGTGAGTGGGTAAAGCTGG - Intergenic
1149564442 17:57631097-57631119 AGGTGGGAAGTGGGTAAAGTGGG - Intronic
1151099107 17:71535390-71535412 AAGAAGGAAGTGGGTTGACAAGG + Intergenic
1151348167 17:73515991-73516013 AGGAAGGAGATGGGGAAAGAGGG + Intronic
1151377939 17:73704190-73704212 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1151400261 17:73851263-73851285 AGGGAGGAGGTGGGCATAAAGGG + Intergenic
1151484507 17:74389918-74389940 AGGAAGGAAGGAGGTAAGGAAGG - Intergenic
1151484546 17:74390192-74390214 AGGAAGGAAGGAGGTAAGGAAGG - Intergenic
1151937929 17:77274691-77274713 AGGAAGGAAATGGGCTGAGAGGG - Intergenic
1153140754 18:1970051-1970073 AGGAAGGAAGAATGGATAGACGG + Intergenic
1153153922 18:2127653-2127675 AGGAAAGATGAGGGTCTAGATGG - Intergenic
1153444534 18:5156427-5156449 CTGGAGGAAGTGAGTATAGAGGG + Intronic
1153987668 18:10367891-10367913 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1154166054 18:12015298-12015320 AGGCTGGAAGTGGGTCAAGAGGG - Intronic
1155333171 18:24738322-24738344 AGAAAGCAGGTGGGTAGAGAAGG + Intergenic
1156597725 18:38566631-38566653 AGGAAGGAAGAAGGGAGAGAGGG + Intergenic
1157115489 18:44859029-44859051 AGGAAGGAAGAGAGGAAAGAAGG + Intronic
1157119457 18:44895255-44895277 AGGAAGGAAGGGGGGAGGGAGGG + Intronic
1157119474 18:44895292-44895314 AGGGAGGAAGGGGGGAGAGAGGG + Intronic
1157404617 18:47412514-47412536 GGCAAGGAAGTGTGTATGGAGGG - Intergenic
1157566306 18:48681163-48681185 TGGAAGGAAGAGGGTGTAGGAGG - Intronic
1157588200 18:48818631-48818653 ACGCAGGAAGAGAGTATAGATGG + Intronic
1157726884 18:49971239-49971261 GGGAAGGAGGTGAGTAGAGAGGG + Intronic
1157804315 18:50646708-50646730 AGGAAAGAAGTGGGGCCAGATGG - Intronic
1158848715 18:61472218-61472240 AGGAAGGGAGTGGGAACAAAAGG - Intronic
1159134308 18:64318996-64319018 AGGAAGGAAGGAGGGATGGAGGG - Intergenic
1159337443 18:67088333-67088355 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1159563531 18:70022315-70022337 AGGAAGGATGTGGATTTAGGAGG - Intronic
1160497087 18:79382113-79382135 AGGAAGGAACAGGGTCTACAGGG - Intergenic
1160872105 19:1282304-1282326 AGGAAGGGAGGGGGTATTAAGGG + Intergenic
1161217022 19:3099684-3099706 AGGCAGGGAGTGGGGATGGAGGG - Intronic
1161260027 19:3332626-3332648 AGGAAGGAAGTAGGGAAGGAAGG - Intergenic
1161507237 19:4650500-4650522 AGGAAGGAGGTGGGTGGAGGGGG + Intronic
1161636544 19:5392871-5392893 TGGAAGGAAGTGGGGAGGGAGGG - Intergenic
1161690907 19:5733379-5733401 AGGAAGGAAGGAGGCAGAGAGGG - Intronic
1161754155 19:6119393-6119415 AGGAAGGAAGAAGGAATGGAGGG - Intronic
1161777835 19:6273384-6273406 GGGAAGAAAGTGGGGATGGACGG + Intronic
1161832833 19:6621708-6621730 AGCAACAAAGTAGGTATAGAAGG + Intergenic
1161913913 19:7214855-7214877 AGGAAGGAGGTGGGGACGGAGGG - Intronic
1162019182 19:7860952-7860974 AGGAAGGAAGGGAGGAGAGAGGG + Intronic
1162633510 19:11947019-11947041 TGGAAGAAAGTAAGTATAGATGG + Intronic
1163055408 19:14714094-14714116 GGGGAGGAAGTGGGCACAGAGGG + Intronic
1163214787 19:15868457-15868479 AGGAAGGAAGAAGGGAGAGATGG + Intergenic
1164441737 19:28284631-28284653 AGGAAGGTAGAGGGAAAAGAGGG + Intergenic
1164529812 19:29039866-29039888 CGTAAGCAAGTGGGTAGAGAAGG + Intergenic
1164588660 19:29494422-29494444 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1164915146 19:32046135-32046157 AGGAAGGAAGGGGGGAGGGAGGG + Intergenic
1165332866 19:35151040-35151062 AGGAAAGTAGAGGGTACAGAGGG + Intronic
1165336997 19:35177785-35177807 AGAAGGGAACTGGGTATTGATGG + Intergenic
1165340471 19:35208228-35208250 AGAAAGGAAATGGGTAGAGTAGG + Intergenic
1165447671 19:35865493-35865515 AGGAAGGAATTAGGTAGACATGG - Intronic
1165639176 19:37369880-37369902 AGGATGGCAGTGGGAACAGAAGG - Intergenic
1166803503 19:45471772-45471794 AGGAAGGGAGTGGGTTTTGGGGG - Intronic
1167344929 19:48939450-48939472 AGGAAAGAAGCGGGTCCAGATGG - Exonic
1167552421 19:50170116-50170138 AGGAAGGAAGGGAGGAGAGAAGG - Intergenic
1167615583 19:50531138-50531160 AGGCAGGAGGTGGGCATGGAGGG - Intronic
1167769227 19:51503641-51503663 ATTATGGAAGTGGGTCTAGAGGG - Intergenic
1167796189 19:51710693-51710715 ACAAGGGAAATGGGTATAGATGG + Intergenic
1168143940 19:54408644-54408666 AGGAAGGAAGGGGGGAGGGAGGG + Intergenic
925212357 2:2060743-2060765 AGAGAGGAAGTGGGCAAAGATGG - Intronic
925340217 2:3130998-3131020 AGGCAGGAAGTGGACAGAGAGGG + Intergenic
926215127 2:10901676-10901698 TGGATGGAGGTGGGTAGAGAAGG - Intergenic
926264633 2:11304285-11304307 AGGAGGGAAGTGGTTGTAGTAGG - Intronic
926291969 2:11538796-11538818 AGGAAGGAAGGAAGTAAAGAAGG - Intronic
926383476 2:12314107-12314129 AGAGAGGAAGTGGGTATGTATGG + Intergenic
926643848 2:15266749-15266771 AGTAAGTAAGTAGGTAGAGAAGG - Intronic
926655138 2:15395381-15395403 AGGAAGGTAGTGGGGATGGCAGG + Intronic
926667857 2:15544368-15544390 AGGAAGGAAGGCGGGAAAGAGGG + Intronic
927019161 2:18999478-18999500 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
927746387 2:25625735-25625757 AGGAAGGAAGAGGGCAGAGATGG - Intronic
928166127 2:28973383-28973405 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
928326192 2:30321538-30321560 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
928373787 2:30759198-30759220 GGGAAGGCAGGGGGTAAAGAAGG - Intronic
928835684 2:35541685-35541707 AGGAAGGAAGGAGGGAGAGAAGG - Intergenic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
929261701 2:39873120-39873142 AGGAAGGAAGGGGAGAGAGAGGG - Intergenic
929383097 2:41376403-41376425 AGAAAGGAAGTGGATTAAGATGG - Intergenic
929488505 2:42375817-42375839 AGGAGAGAAGTGGGCATAGGGGG + Intronic
929775255 2:44926987-44927009 AGGGAGGGAGTGGGTAGTGATGG - Intergenic
930189091 2:48440205-48440227 GAGAATGAAGTGGGTAGAGACGG + Intergenic
930539726 2:52690599-52690621 AGGAAGGAAGAGGGGAGGGAGGG - Intergenic
930654183 2:53992018-53992040 AGGAAGGAAGGAGGGAAAGAGGG - Intronic
930665800 2:54097207-54097229 AGGAAATAAGTGGGTTAAGAAGG - Intronic
930961083 2:57262502-57262524 AGGAAGAAAGTAGGTAAGGATGG + Intergenic
931121658 2:59226485-59226507 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
931512051 2:63009431-63009453 AGGAAGGAATGGGGTATGGGTGG + Intronic
931572365 2:63681698-63681720 AGGGAGGCAGTGGTTACAGAGGG + Intronic
931826327 2:66004279-66004301 AGGAAGGAAGGGAGGAGAGAAGG - Intergenic
932057707 2:68462826-68462848 AGGGTGGAAGTGGGGCTAGAAGG + Exonic
932486825 2:72089242-72089264 AGGAAGGAAGATGGGAGAGAAGG + Intergenic
932587356 2:73039546-73039568 CGGAAAGAAGTGTGTTTAGAGGG + Intronic
932991392 2:76792359-76792381 TGGAGGAAAGTGGTTATAGAAGG + Intronic
933031705 2:77336291-77336313 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
933185878 2:79278811-79278833 AGAAAAGAAGAGGGTAAAGAGGG + Intronic
933643765 2:84792624-84792646 AAAAAGGAAGTGTGTATGGAGGG + Intronic
933805603 2:85996509-85996531 AGGAAGGAGGTGGGTATCTTTGG + Intergenic
933865143 2:86509337-86509359 AGGAAGGAACTGGGTCAGGAGGG - Intronic
934789850 2:97049902-97049924 AGGAAGGAAGAGGCTCTGGAAGG - Intergenic
934816619 2:97332637-97332659 AGGAAGGAAGAGGCTCTGGAAGG + Intergenic
934821077 2:97375847-97375869 AGGAAGGAAGAGGCTCTGGAAGG - Intergenic
935415576 2:102813892-102813914 AGGAAGGAAGGAGGGACAGAGGG - Intronic
935448501 2:103182219-103182241 AAGAAGGAAGGGGGGAAAGAAGG + Intergenic
935626173 2:105174001-105174023 AGGAAGAAAGGGTGAATAGATGG + Intergenic
936233540 2:110724831-110724853 AGGAAGGAAGGAGGCACAGACGG + Intergenic
936233575 2:110724955-110724977 AGGAAGGAAGGAGGCATGGAGGG + Intergenic
937290535 2:120779058-120779080 GGGAAGGGTGTGGGTATATAGGG - Intronic
937766009 2:125661214-125661236 AGGAAGGAGATGGATATGGAGGG + Intergenic
937956403 2:127423811-127423833 AGGAAGCAAGGGGGTAAAGAGGG - Intronic
938031558 2:127998925-127998947 AGGAAGGAAATGGGCTGAGATGG + Intronic
938747171 2:134290437-134290459 AGGAAGGAAGTGTGTAAGAAAGG - Intronic
938771585 2:134505490-134505512 AGGAAGGAAGGGGGTCTCGTGGG + Intronic
940159574 2:150696914-150696936 AGGAAGGAAGGAGGGAAAGAGGG + Intergenic
940668585 2:156639677-156639699 AGGAGGGAAGTGGGTACTGGAGG - Intergenic
940702926 2:157068937-157068959 AGGAAGGCAGTGGGAAGAGAGGG - Intergenic
941302939 2:163827314-163827336 AGCCAGGAAGTGGTTACAGAAGG - Intergenic
941339356 2:164287154-164287176 AGGAAGGGAGGGAGAATAGAAGG + Intergenic
941513693 2:166445364-166445386 AGGAAGGAAGAGGGGAGGGAGGG + Intronic
942243573 2:173986504-173986526 AGGAAGTAAGTGGGTTAAGCTGG - Intergenic
942255253 2:174090670-174090692 AGAAGGGAAGTGGGGAAAGATGG + Intronic
942394634 2:175534408-175534430 AGGAAAGAAGTGAGTTGAGAAGG + Intergenic
942629396 2:177939378-177939400 AGGAAGGAAGGAGGGAGAGAGGG + Intronic
942927987 2:181456837-181456859 AGGAAGGAAGTGGGTATAGAAGG + Intergenic
943706647 2:191042099-191042121 AGGACGGTGTTGGGTATAGAAGG - Intronic
944780579 2:203013257-203013279 AGGAAGAAAGTGTGGAGAGATGG + Intronic
944991805 2:205246438-205246460 AGGAAGGAAAAAGGAATAGAAGG - Intronic
945180103 2:207083042-207083064 TGGAAGTAAGTGGGTATAATTGG - Intronic
945807625 2:214509543-214509565 TGGATGGAAGTGGGAGTAGAGGG + Intronic
945896980 2:215494457-215494479 AGGAAGGAAGTGAGGAAGGAAGG - Intergenic
946996444 2:225397799-225397821 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
947753110 2:232543053-232543075 AGGAAGGAAGTGGATGAGGATGG - Exonic
948068554 2:235101211-235101233 AGGAAGGGAGTGGGGAGGGAAGG + Intergenic
948282761 2:236760463-236760485 AGGAAGGAAGGAGGGAAAGATGG + Intergenic
948282772 2:236760511-236760533 AGGAAGGAAGGAGGGAAAGATGG + Intergenic
1168955077 20:1828961-1828983 AGGGAGGAAGGGGGGAAAGAGGG - Intergenic
1169520669 20:6369488-6369510 GAGAAGAAACTGGGTATAGAAGG + Intergenic
1169738669 20:8866186-8866208 AAGAAGGAAATGGGAAAAGAGGG + Intronic
1169835601 20:9874425-9874447 AGCTAGGAAGTGGGTGTAGGAGG - Intergenic
1170053315 20:12171232-12171254 TGGTAGGAAGAGGGTATTGATGG + Intergenic
1170838854 20:19907611-19907633 AGGAAGGAAGAGGGTGGAGGTGG + Intronic
1170881039 20:20296495-20296517 AGGAAGGAAGGGAGTAAAGAAGG - Intronic
1170934347 20:20796857-20796879 AGGCAGAAAGTGGGTAGGGAGGG + Intergenic
1171519789 20:25766877-25766899 AGGAAGGAACTGGGGAGCGAGGG - Intronic
1171557131 20:26089616-26089638 AGGAAGGAACTGGGGAGCGAGGG + Intergenic
1171721678 20:28569764-28569786 AGGAAGGAAGTAGGGAGGGAGGG - Intergenic
1171774563 20:29353173-29353195 AGGAAGGAAGGGGACAAAGAAGG - Intergenic
1171816581 20:29790799-29790821 AGGAAGGAAGGGGACAAAGAAGG - Intergenic
1171862400 20:30412926-30412948 AGGAAGGAAGTAGGGAGGGAGGG + Intergenic
1171862413 20:30412966-30412988 AGGAAGGAAGTAGGGAGGGAGGG + Intergenic
1172919770 20:38471819-38471841 AGGAAGGAAGAGGGAAAAGGAGG - Intergenic
1173008001 20:39155930-39155952 GGGAAGGAAGTTGGTATTTAGGG + Intergenic
1173148734 20:40547691-40547713 AGGAAGGAAATGGGTATCCTTGG + Intergenic
1173415026 20:42847457-42847479 AGGGTGGAGGTGGGTAAAGATGG + Intronic
1173464558 20:43270718-43270740 AGGAAGGAAGAAGGGAGAGAGGG + Intergenic
1173830723 20:46085474-46085496 AGGAAGAATGTGTGTATGGAGGG + Intronic
1174044418 20:47723381-47723403 AGGAAGGAAGAGAGAATGGATGG + Intronic
1174869332 20:54168754-54168776 AGGAAGGAAGGAGGGAGAGAAGG - Intronic
1175313284 20:58026533-58026555 GGGAAGGAGGTGGCCATAGAGGG + Intergenic
1175496854 20:59420532-59420554 AGGAAGGAAGGGGGGAAGGAAGG - Intergenic
1177237331 21:18409836-18409858 AGGAAGGAAGGGGGAAAGGAGGG - Intronic
1177674375 21:24277315-24277337 AGGGAGGGAGTGGGGAGAGAGGG - Intergenic
1178057078 21:28811415-28811437 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
1178169663 21:30026087-30026109 AGGCAGGAAGCGTGTATAGCAGG - Intergenic
1178379125 21:32093533-32093555 AGGAAGGAAGAGGGGAAGGAAGG - Intergenic
1179061471 21:37983207-37983229 AGGAAGGAAGGAGGGAAAGAAGG - Intronic
1180000600 21:44993718-44993740 GGGAAGGAGGTGGGTGGAGATGG - Intergenic
1180413447 22:12637626-12637648 AGGAAGGAAGTAGGGAGGGAGGG + Intergenic
1180631772 22:17234795-17234817 ATGGAGGAAGTGGGTCCAGATGG + Intergenic
1180999996 22:19983557-19983579 AGGAAAGAAGTGGCCACAGAAGG + Intronic
1181047996 22:20224600-20224622 AGGAAGGAACTGGGCACAGGGGG + Intergenic
1181773487 22:25143510-25143532 AGGAAGGAAGGGAGGAGAGAAGG - Intronic
1182592084 22:31389393-31389415 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
1182962410 22:34488177-34488199 AGGAAGGAAGTGAGGAAAGGAGG - Intergenic
1183027720 22:35078504-35078526 GGGAGGGAAGGGGGTAGAGAAGG + Intronic
1183786454 22:40031675-40031697 AGGAAGCAAGTTGGCATAGTGGG + Exonic
1184473110 22:44707085-44707107 AGGAAGGAAGGGGATAAGGATGG - Intronic
1185004558 22:48268070-48268092 AGGAAGGAGGAGGGTATCCATGG + Intergenic
1185139893 22:49094234-49094256 TGGAAGGGAGGGGGTATGGACGG + Intergenic
1185401529 22:50620691-50620713 AGGAAGGAAGAGGGGATATCCGG - Intergenic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
949522411 3:4868809-4868831 AGGAAGGAAGTGGGTGTCACGGG + Intronic
949881604 3:8665300-8665322 AGCAAGGAAGGAGGTAGAGAGGG + Intronic
949978490 3:9482408-9482430 ATGAAGGAAGGGGGTGTGGAGGG + Intergenic
950311262 3:11960070-11960092 AGGAAGGAGGTAGGTAAAGATGG + Intergenic
950462146 3:13130951-13130973 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
950907552 3:16552949-16552971 AGGAAGGAAGAAGGGAAAGAAGG + Intergenic
951103595 3:18717580-18717602 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
951352783 3:21626921-21626943 AGAAAAGAACTGGGTATTGAGGG + Intronic
951418746 3:22458056-22458078 AGGAAGGAGGTGGGGAAGGAGGG + Intergenic
951788544 3:26452624-26452646 TGGAGGGAAGAGGGTATAGGAGG + Intergenic
951816841 3:26763828-26763850 AGGAAGGAAGTGAGGAAGGAAGG + Intergenic
952489266 3:33850900-33850922 AGGAAGGAAGGGGGAAGGGAAGG - Intronic
952590110 3:34942494-34942516 AGGAAGGAAGTAGGAAGGGAGGG - Intergenic
953283246 3:41579338-41579360 AGGAAGGAAGGAGGAACAGATGG + Intronic
953296529 3:41723375-41723397 AGGAAGAAAGAGGATAAAGAAGG - Intronic
953517692 3:43612234-43612256 AGAAAGAAAGAGGGTTTAGAGGG - Intronic
953814523 3:46143706-46143728 AGGAAGCAAGAGGGTTGAGAAGG + Intergenic
954093885 3:48307380-48307402 AGGAAGGAAGGGGAAAGAGAAGG - Intronic
954295990 3:49674671-49674693 GGGAAGGAAGGGGGTGTGGAGGG + Intronic
955433506 3:58874245-58874267 TGGAAGGAAGTGGACATGGATGG - Intronic
955770896 3:62383940-62383962 AGGAAGGAAGGGTGGGTAGAGGG - Intergenic
955796642 3:62644338-62644360 AGGAAAGTAGTGGGTAGGGAGGG + Intronic
956304845 3:67812333-67812355 AGGAAGGAAGTGCTTCAAGAAGG + Intergenic
956309001 3:67858541-67858563 AGGAAGGAGGTGGGTGGAGGAGG + Intergenic
956378917 3:68645163-68645185 AGGAAGGCATTGAGAATAGACGG - Intergenic
956690659 3:71875262-71875284 AGGAAGGAACTTGGTACAGGTGG - Intergenic
956869869 3:73406345-73406367 GGGAAGGAATGGGGTGTAGATGG + Intronic
957515176 3:81240765-81240787 AGGAAGGAAGGAGGAAGAGAGGG + Intergenic
957595282 3:82257053-82257075 AGGGAGAAGGTGGGTAGAGAGGG + Intergenic
958161216 3:89818622-89818644 AGGGAGGAAGTGTGTGTTGACGG + Intergenic
958692226 3:97482593-97482615 ATGAAGGCAATGGGCATAGAAGG + Intronic
958792021 3:98662829-98662851 AGGAAGGAAGGAGGGATGGAAGG - Intergenic
959652452 3:108764121-108764143 AGGAAGGGGATGGGTCTAGATGG + Intergenic
959758677 3:109930144-109930166 AGGAAGGAAGGGAGGATGGAAGG - Intergenic
959796476 3:110435545-110435567 AGGAAGGAAGTTGATAATGAAGG - Intergenic
960136512 3:114111057-114111079 AAGAAGGAGGTGGTTATACAGGG + Intergenic
960252965 3:115477117-115477139 AGAGAGGAAGTTGGTGTAGAGGG + Intergenic
960548437 3:118945597-118945619 AGGAAGATAATGGGGATAGAAGG + Intronic
960951339 3:123000447-123000469 AGGCAGGAAGAGGCTATAAAGGG + Intronic
961207244 3:125094469-125094491 AGGAAGGAAGGCAGAATAGAGGG - Intronic
961920487 3:130420147-130420169 AGGAAGGAAGAGAGGAAAGAAGG + Intronic
962037433 3:131667588-131667610 AGGAAGGGAGGGGGGAGAGAAGG - Intronic
962351798 3:134661744-134661766 AGGAAGGAAGAGGGGAAGGAAGG + Intronic
962397023 3:135025109-135025131 AGGAAGGAAGGGGGGAGGGAGGG - Intronic
963348404 3:144123919-144123941 AAGTTGGCAGTGGGTATAGATGG - Intergenic
963526893 3:146426245-146426267 AGGAAGGAAGGAGGGAGAGAGGG - Intronic
963550119 3:146709568-146709590 AGCAAGGAAGTGGGGTTTGATGG + Intergenic
963790312 3:149576497-149576519 AGGAAGGAGGTGGGAGTAGCGGG - Intronic
964172639 3:153789398-153789420 AGGAGGTAAGTGGTTATGGAGGG - Intergenic
964194488 3:154046820-154046842 AGGAAAGAAGTGAGTAGAGCAGG + Intergenic
964969464 3:162542090-162542112 AGGAAGGAAGGGAGGAGAGAGGG - Intergenic
967277373 3:187789902-187789924 AGGAAGGAAGAGGGGAAGGAGGG + Intergenic
967360511 3:188624905-188624927 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
968073545 3:195802985-195803007 AGGGAGGGAGTGTGTACAGACGG - Intronic
969089616 4:4684043-4684065 CCCAAGGAAGAGGGTATAGAAGG - Intergenic
969717914 4:8877359-8877381 AGGAAGGAAGAGGGGGTGGAAGG + Intergenic
969822096 4:9728441-9728463 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
969909398 4:10429326-10429348 GAGAAGGAAGTGAGTATGGAAGG + Intergenic
970139722 4:12968715-12968737 AGGACGAAACTGGGTATTGATGG + Intergenic
970341865 4:15115743-15115765 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
970377125 4:15469992-15470014 AGGATGGAAGTGGAGAGAGACGG - Exonic
970650125 4:18168424-18168446 AGGATGGTAATGGGTATAGCAGG + Intergenic
971357039 4:25904472-25904494 GGGAAAGGTGTGGGTATAGATGG + Intronic
971849086 4:31960219-31960241 AGGAAGGAAGTGGGGAAGGAAGG - Intergenic
971908863 4:32767559-32767581 AGGAATGCAGTGGCTATACAGGG - Intergenic
972046513 4:34671668-34671690 AGGAAGGAAGCTAGTATAGTTGG + Intergenic
972579838 4:40385479-40385501 AGGAAGGAAGGAGGGAGAGAAGG + Intergenic
973026529 4:45280270-45280292 AGAAAGTAAGTGGGTATTGCTGG + Intergenic
973054774 4:45641946-45641968 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
973063597 4:45761406-45761428 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
973755001 4:54065475-54065497 AGGAAGGAAGAAAGGATAGAAGG + Intronic
973765358 4:54157140-54157162 AGGAAGGAAGGGGGGAGGGAGGG + Intronic
973765377 4:54157185-54157207 AGGAAGGAAGGGGGGAGGGAGGG + Intronic
974031047 4:56777317-56777339 AGGAAGGAAGTGGGCCAAGGAGG - Intergenic
974379647 4:61122134-61122156 AGGAAGGAAGTGAGGAAGGAAGG - Intergenic
974779925 4:66541899-66541921 AGGAAGGAAGGAAGAATAGAAGG + Intergenic
975179130 4:71323420-71323442 AGGAAGGATCTGGGTATAGCTGG + Intronic
975854093 4:78604437-78604459 AGTAAGGAGATGGGTAGAGAAGG - Intronic
975988858 4:80236040-80236062 AGGGAGGGAGAGGGTATGGAAGG - Intergenic
976005987 4:80431359-80431381 GGGAAGGAAGGGGGGAGAGATGG - Intronic
976413545 4:84745167-84745189 AGCAAGGAACTGGGAACAGAGGG + Intronic
976885048 4:89971578-89971600 AGGAGGGAAGAGGGAAGAGATGG - Intergenic
977121987 4:93113756-93113778 AGGAAGGAGCTTGTTATAGATGG + Intronic
977263225 4:94823274-94823296 AGAATGGAAGTGGGCAGAGAAGG + Intronic
977589666 4:98812778-98812800 AGGAAGGTAGGAGGTATATAGGG - Intergenic
977728063 4:100320770-100320792 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
977779589 4:100965155-100965177 AGGCAGAAAGTAGGTACAGAGGG + Intergenic
978145880 4:105371534-105371556 AGGAAGGAAGGGGTCATAGTTGG - Intronic
979101074 4:116615362-116615384 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
979101110 4:116615530-116615552 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
979698566 4:123641002-123641024 AGGAAGGAAGGAGGGAGAGAGGG + Intergenic
980060453 4:128123191-128123213 AAGAAGGCAGTGGTTACAGAAGG - Intronic
980121183 4:128730182-128730204 AGGAAGGAAATAGGTATAGGTGG - Intergenic
980253418 4:130347424-130347446 AGGAGGGAAGTGGTCATTGATGG - Intergenic
980838270 4:138224781-138224803 AGGAAGGAAGAAGGAAAAGAAGG + Intronic
980953575 4:139406268-139406290 AGGAAGGAAGTGGCAGAAGAGGG + Intronic
981186293 4:141807789-141807811 AGAATGGAAGTGGGCATACAGGG - Intergenic
981414684 4:144478290-144478312 CTGAAGAAACTGGGTATAGAAGG - Intergenic
981540722 4:145843861-145843883 AGGAAGGATGTGGTTTTAGCTGG - Intronic
982168830 4:152641371-152641393 AGGAAAGAATTGGGTAAAGTGGG + Intronic
983066525 4:163216298-163216320 AGGAAGGAAGGGAGGAGAGAGGG + Intergenic
983110372 4:163742374-163742396 AGGAAGGAAGGAGGTAGCGAGGG - Intronic
983542610 4:168929150-168929172 AGGAAGAAAGTAAGTATAAATGG + Intronic
984421786 4:179532610-179532632 AGGGAGGAAGGAGGCATAGAAGG + Intergenic
985273545 4:188216603-188216625 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
985273550 4:188216619-188216641 GGGAAGGAAGGGGGTAAGGAAGG - Intergenic
985944149 5:3163675-3163697 ATGGAGGAACTGGGTTTAGAAGG + Intergenic
986329647 5:6708310-6708332 AGGAAGGAGGTGGGGGAAGAAGG - Intergenic
986361480 5:6982222-6982244 GGGGAGGAAGTGGCTATAGTGGG - Intergenic
986613898 5:9597208-9597230 AGGAAGAAAGTGGGAATTAAAGG - Intergenic
987149856 5:15027765-15027787 AGGAAGAAAGAGGTTATAGTAGG + Intergenic
987960164 5:24796908-24796930 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
988346071 5:30039464-30039486 AGGAAGGAAGAAGGGATGGAGGG + Intergenic
988623629 5:32848409-32848431 AGGAAGGAAGGAAGGATAGAAGG - Intergenic
988728908 5:33950678-33950700 GTGAAGGAAGTGGGAAGAGATGG - Intronic
989784065 5:45305784-45305806 AGGAAGGAAGGAGGGAAAGAAGG + Intronic
990368676 5:55095015-55095037 AGGAATGAGGTGGGTACAGGAGG + Intergenic
990501357 5:56399616-56399638 AGGTAGTAACTGGGTACAGATGG + Intergenic
990628156 5:57637608-57637630 AGTAAGGAAGTTGGGAAAGAAGG + Intergenic
990992344 5:61698418-61698440 AGGAAGTCAGTGTGTCTAGAGGG - Intronic
992720611 5:79557289-79557311 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
993439381 5:87936947-87936969 AGGAAGGAAGTAGGTAGGGAGGG - Intergenic
993439420 5:87937141-87937163 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
993526250 5:88969327-88969349 AGGAAAGATGTGGGTAGAGAAGG - Intergenic
993757933 5:91754399-91754421 AGGGAGGAAGTGACTATAAAAGG + Intergenic
994103881 5:95923905-95923927 AAGAATGAAATGGGTATATAAGG + Intronic
995073707 5:107956022-107956044 AGGAAGAAAGTGGACACAGAAGG + Intronic
995248089 5:109958520-109958542 AGGAAGGAAGGGGGTAAAGGTGG + Intergenic
995345086 5:111104547-111104569 AGGGAGGGAGTGGGTATTGGGGG - Intronic
995829864 5:116343950-116343972 AGGAAGAAAGTGGGGAAACAGGG + Intronic
996155910 5:120100057-120100079 AGCAAAGCAGTGGCTATAGAGGG - Intergenic
996216120 5:120868803-120868825 AGTAAGGAAGTGGAGATAAATGG - Intergenic
997379049 5:133422145-133422167 AAGAAGGACGTGGGCAAAGATGG + Intronic
997953177 5:138258043-138258065 AAGAAGGTAGTGGATATAGGAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998305580 5:141072856-141072878 AGGAAGGAAGGGGAAAAAGAGGG + Intergenic
998589255 5:143460112-143460134 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
998814864 5:146002889-146002911 GGGTAGGAGGTGGGGATAGAGGG - Intronic
999075200 5:148789054-148789076 AGGAAGCAAGAGGGGAAAGAGGG - Intergenic
999134741 5:149311167-149311189 AGGAAGGGGCTGGGTAGAGAGGG - Intronic
999154872 5:149450907-149450929 CAGAAGGAAGAGGGGATAGAAGG - Intergenic
999371230 5:151056556-151056578 AGGAAGGAAATGGGGAAATACGG - Intronic
999481231 5:151949981-151950003 AGAGAGGAAGTGGGGAAAGAAGG - Intergenic
999635330 5:153615996-153616018 AGGATGGGAGTGGCTACAGAGGG + Intronic
999967746 5:156827777-156827799 AGGAAGGAAGGGAGGAAAGAAGG + Intergenic
1000070930 5:157740517-157740539 GGGAAGGTAGTGGGAATAGGTGG + Exonic
1000606431 5:163332389-163332411 ATGAAGGAAGTAGGTGTAGAAGG - Intergenic
1000710830 5:164575555-164575577 AGGAAGGAAGGAGGAAGAGAGGG + Intergenic
1000745960 5:165034207-165034229 ATGAAGTAAGGGGGTAAAGAGGG - Intergenic
1001148061 5:169202279-169202301 AGGAAGGAAGGATGGATAGATGG - Intronic
1001306606 5:170579136-170579158 AGGAAGGTAGTGAATATGGATGG - Intronic
1001421359 5:171589734-171589756 AAGAAGGAGTTGGGCATAGAGGG + Intergenic
1001545942 5:172570673-172570695 AGGAAGGAAGGAGGGAAAGATGG + Intergenic
1001793467 5:174481885-174481907 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1001802890 5:174558921-174558943 AGGAAGGAAGGGGGGAAGGAGGG - Intergenic
1001862936 5:175075108-175075130 AGGAAGGAAGGAGGAAGAGAGGG - Intergenic
1002102356 5:176863779-176863801 AGGGAAGAAGGGGGTAAAGAAGG - Intronic
1002370738 5:178752044-178752066 AGGAAGGAAGCAGGCAGAGAGGG - Intergenic
1002969253 6:1997102-1997124 AGGAAGGGATGGGGTAAAGAGGG + Intronic
1003251112 6:4429877-4429899 AGGAAGGAAGTGGATATCCCTGG + Intergenic
1003935362 6:10970351-10970373 AGGAAGGGTGTGGGTGTGGATGG + Intronic
1004031328 6:11871966-11871988 AGGAAGGAAGGGAGGATGGAAGG - Intergenic
1004114294 6:12750542-12750564 AGGAAGGAAGGGGGGAAGGAAGG + Intronic
1004139284 6:13000631-13000653 AGGAAGGAAGGGGGGAGGGAGGG + Intronic
1004331267 6:14723676-14723698 AGGAAGGAAGGGGGGAAGGAAGG + Intergenic
1004389939 6:15201685-15201707 AGCAAGGAGGTGGGTCTACAAGG - Intergenic
1004839023 6:19561494-19561516 AGGAAGGAAGTAGGGATGAAAGG + Intergenic
1005221460 6:23593343-23593365 AGGAAGGAAGCGAGAAAAGAAGG + Intergenic
1005572293 6:27157107-27157129 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1005838599 6:29725310-29725332 AGGAGGGAGATGGGTAAAGAGGG + Intronic
1006000675 6:30962792-30962814 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1006000687 6:30962839-30962861 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
1006345980 6:33483127-33483149 AGGCAGAAAGTGGCAATAGAAGG - Intergenic
1006670969 6:35729368-35729390 AGGAAGAAGGTGGGAGTAGATGG - Intergenic
1006727065 6:36207156-36207178 AGGAAGGCATGGGGTAGAGAGGG + Intronic
1007005342 6:38357214-38357236 ATGAATGAAGTGGGTAGGGAAGG - Intronic
1007138332 6:39544876-39544898 AGGAAGGAGGAGGGGAAAGAAGG - Intronic
1007302307 6:40876535-40876557 AGGAAGGAAGGAGGGATGGAAGG - Intergenic
1007413354 6:41677935-41677957 AGGCAGGGAGTGGGGAAAGATGG + Intergenic
1007476389 6:42122516-42122538 AGGAACCAGGTGGGTAGAGAAGG + Intronic
1007814416 6:44510356-44510378 ATGAAGGGAGTGGAGATAGAAGG + Intergenic
1007954570 6:45904656-45904678 AGGAAGGAAGGGAGTAGGGAGGG - Intronic
1008124235 6:47650557-47650579 AGGGAGGAATGGGGTATGGAGGG + Intergenic
1008847292 6:55983425-55983447 AGGATGGGCGTGGGTAGAGAGGG - Intergenic
1009284523 6:61799790-61799812 TGGAAGAATGTGGATATAGAAGG - Intronic
1009408155 6:63333585-63333607 AGGAAGGAAGGGGGGAGGGAGGG + Intergenic
1009804188 6:68580995-68581017 AGGTTGGAGGTGGGTAAAGAAGG - Intergenic
1009854264 6:69240680-69240702 AGGAAGGAAGTAGAGATAAAAGG + Intronic
1010062887 6:71645499-71645521 AGAAAGGGAGTGGGGAGAGAGGG + Intergenic
1010475819 6:76286266-76286288 AGGAAGGAAGTATATATAGAAGG - Intergenic
1010870359 6:81029578-81029600 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1011889744 6:92143035-92143057 AGGAAGGAAGGAAGGATAGAAGG + Intergenic
1011958666 6:93057636-93057658 AGGAAGGAAGTGAGGAAGGAAGG + Intergenic
1011970046 6:93211408-93211430 AGGAAGGAAGCGGGGAAAGGGGG + Intergenic
1012260351 6:97081210-97081232 AGGAAGGAAGTGGGCAAAGCAGG + Intronic
1013123281 6:107159338-107159360 AGGAAGGAAGAAGGGAAAGAAGG + Intronic
1013209015 6:107970310-107970332 AGGAAGGAAGGAAGGATAGAAGG - Intergenic
1013332634 6:109120486-109120508 GGGAAGGTAGTGGGTGTAGTTGG + Intronic
1013715910 6:112961375-112961397 AGGAAGGCAGTGTGTATAGTGGG + Intergenic
1013760514 6:113512127-113512149 AGGAAGAAAGAGGGTATAAGAGG - Intergenic
1014654351 6:124080766-124080788 AAGAAGGAAGAGGATATAAAAGG - Intronic
1014865157 6:126520738-126520760 AGCCAGGGAGTGGTTATAGAAGG - Intergenic
1015085540 6:129286986-129287008 AGGAAGGAAGGGAGGAAAGAGGG + Intronic
1015085562 6:129287057-129287079 AGGAAGGAAGGGAGGAAAGAGGG + Intronic
1015383981 6:132601007-132601029 AGGAAGGAAGGGGGGAAGGAGGG + Intergenic
1015502955 6:133952542-133952564 GGGAAGGAAGTGGGGAGAGATGG - Intronic
1015815353 6:137205268-137205290 AGAAAGGAAGTGAGGCTAGAGGG + Intronic
1016451070 6:144182770-144182792 TGGAAGGAAATGGGTAGATAAGG - Intronic
1016535011 6:145100066-145100088 AGGAAGGAAGAGGGAAGGGAAGG + Intergenic
1017010334 6:150059140-150059162 AGGAAGGAAAAGGATATAAAAGG - Intergenic
1017034718 6:150256936-150256958 AGTAATGAAGTGGGTATCCAAGG - Intergenic
1017106304 6:150891656-150891678 GGCAAGGATGTGGATATAGATGG + Intronic
1017570595 6:155740993-155741015 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1017799482 6:157880300-157880322 AGGGAAGAAGTGGGAAAAGAAGG - Intronic
1018111501 6:160540890-160540912 AGGAGGGAAGTGTTTCTAGAGGG - Intronic
1018234526 6:161710974-161710996 AGGAAGGAAAGGGGAAAAGAGGG - Intronic
1018631622 6:165826946-165826968 AGGTAGGAAGTGGGGACAGAGGG + Intronic
1018781926 6:167076121-167076143 AGGAAGGAAGGGAGTAAGGAAGG - Intergenic
1018885918 6:167937099-167937121 AGGAAAGGAGTGTGTACAGAAGG + Intronic
1019108304 6:169688364-169688386 AGGAGAGAAGTGGGCATTGACGG + Intronic
1019334913 7:478506-478528 AGGAAGGAAGAAGGGAGAGAAGG + Intergenic
1019920025 7:4157484-4157506 AGGGAGGAAGAGGGGAGAGAAGG + Intronic
1020325246 7:6969134-6969156 AGGAAAGGAGAGGGAATAGATGG + Intergenic
1020666293 7:11047872-11047894 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1020814505 7:12888652-12888674 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1021045462 7:15917748-15917770 AGGAAGGAAGTGGCTTTATGGGG - Intergenic
1021258225 7:18421351-18421373 AGGAAGGAAGGGGGAAGGGAGGG + Intronic
1021287076 7:18793560-18793582 CAGAAGGAAGAGGGTAGAGATGG + Intronic
1021287977 7:18805877-18805899 AGGAAGGAAGTGGAGTAAGAAGG + Intronic
1021353820 7:19628798-19628820 AGCCAGGAAGTGGTTATAGCAGG + Intergenic
1021385710 7:20027506-20027528 AGGAAGGAAGTGAGTGGGGAAGG - Intergenic
1021447497 7:20749171-20749193 AGGAAGGAAGGAAGTAGAGAGGG - Intronic
1022423793 7:30248397-30248419 AGGGAGGAAGAGGGAAGAGAAGG + Intergenic
1023217718 7:37882517-37882539 AGGAAGGAAGGAGGGAGAGAGGG + Intronic
1023370210 7:39505576-39505598 CAGAAGGAAGATGGTATAGATGG - Intergenic
1023565753 7:41522250-41522272 TGGAATGAAGTGGGAATAGCAGG + Intergenic
1024192722 7:47029178-47029200 AGGATGGAAGAGGATAAAGAAGG + Intergenic
1024974811 7:55103555-55103577 AGGAAGAAAGCTGGTCTAGAAGG + Intronic
1025280276 7:57621828-57621850 AGGAAGGAACTGGGGAGAGAGGG - Intergenic
1025304457 7:57843673-57843695 AGGAAGGAACTGGGGAGAGAGGG + Intergenic
1026111949 7:67465426-67465448 AAGGAGGAAGTGGTTAGAGATGG + Intergenic
1026284187 7:68948674-68948696 AGGAAGGAAGGGGGAAGGGAGGG - Intergenic
1026284198 7:68948706-68948728 AGGAAGGAAGGGGGAAGGGAGGG - Intergenic
1026315076 7:69220833-69220855 AGGAAGGAAGGAAGGATAGAAGG - Intergenic
1026319279 7:69254878-69254900 AGGAAGGAAGAGAGGAAAGAAGG + Intergenic
1026483949 7:70801581-70801603 AGGAAGGAAGTGAACAAAGAGGG - Intergenic
1026589136 7:71680642-71680664 AGGAAGGAAGGAGGGAGAGAGGG - Intronic
1026677193 7:72437835-72437857 AGGAAGGAAGGGAGGATGGAAGG - Intronic
1026927518 7:74204395-74204417 GGGAAGGAAGTAGGGAGAGAGGG + Intronic
1026929368 7:74215357-74215379 AGGCAGGAGGTGGGCAGAGAGGG + Intronic
1027202921 7:76074222-76074244 AGGCAGGAGCTGGGTCTAGAGGG + Intergenic
1027305212 7:76887729-76887751 AGGAGGGAAGTGGGTCTGGCAGG - Intergenic
1027703085 7:81493452-81493474 AGGAAGGAAGGGGGTAGAGAAGG + Intergenic
1027808345 7:82859265-82859287 AGACAGGAAGTGGTTATAGCAGG + Intronic
1027899144 7:84086836-84086858 ATGAAGTAATTGGGTAAAGAAGG - Intronic
1028068484 7:86418604-86418626 AGGGAGGAAGTGAGGAAAGAAGG + Intergenic
1028451234 7:90985844-90985866 TGAAAGGAAGTGGATACAGATGG - Intronic
1028960768 7:96747770-96747792 AGGAAGGAAGGGAGAAAAGAAGG - Intergenic
1029084949 7:98004075-98004097 AGGAAGGAAGGGGGGAGGGAGGG - Intergenic
1029150284 7:98475520-98475542 AGGAAGGAAGGAGGGAGAGAAGG + Intergenic
1029423790 7:100484532-100484554 AGGCAGGCAGTGGAGATAGATGG + Intronic
1029584837 7:101463725-101463747 AGGAAGGGAGGGGGGAGAGAGGG - Intronic
1029618114 7:101672624-101672646 AGGAAGGAAGAAGGGAAAGAAGG - Intergenic
1030469430 7:109945151-109945173 AGGGAGACAGTGGGTGTAGAGGG + Intergenic
1030529761 7:110697871-110697893 TGGAAGGAAATGGCTAAAGATGG + Intronic
1030690996 7:112533308-112533330 AGGAAGGAAGTGGGGAGATAAGG - Intergenic
1031323681 7:120365184-120365206 AGGAAGGAAGGGAGGAAAGAAGG + Intronic
1031411872 7:121449015-121449037 AGGAAGCAAGTAGCTAGAGATGG - Intergenic
1031630168 7:124034305-124034327 AGGAAGGAAGGAGATAAAGAGGG - Intergenic
1032842335 7:135724177-135724199 GGGAAGGAGGTGGGGAGAGAAGG + Intronic
1033454393 7:141489566-141489588 ATGAAGGGAGTGGGGAGAGAAGG - Intergenic
1033985951 7:147225829-147225851 AGGAAGGAAGGAGGGAAAGAAGG + Intronic
1034261030 7:149755655-149755677 AGGAAGGAAGGGGGAAAGGAAGG - Intergenic
1034286697 7:149888656-149888678 AAGGAGGAAGTGGGGAGAGAGGG + Intergenic
1034694716 7:153043445-153043467 AGGAAGGAACTTAGTATAGGAGG + Intergenic
1034926291 7:155124979-155125001 GGGAAGGAAGGGGGCATAGGAGG + Intergenic
1035279177 7:157766461-157766483 AGGAAGGATGGGTGGATAGATGG - Intronic
1035909599 8:3550763-3550785 AGGAAGGATGTGGGAATATGTGG - Intronic
1035912247 8:3580332-3580354 TGGAAGGACGTGGGTTCAGATGG + Intronic
1036255946 8:7206646-7206668 AGGAAGGAAGGGTGGATGGATGG + Intergenic
1036361542 8:8080853-8080875 AGGAAGGAAGGGTGGATGGATGG - Intergenic
1036445861 8:8821287-8821309 AGGTGGGAAGTGGAAATAGAAGG + Intronic
1036495750 8:9268558-9268580 AGGAAGGAAGGGGGGAAGGAGGG + Intergenic
1036707173 8:11054723-11054745 AGGAAGGAAGTGTGGGTGGACGG + Intronic
1036889431 8:12586170-12586192 AGGAAGGAAGGGTGGATGGATGG + Intergenic
1037256407 8:16960447-16960469 AGTAAGGAATTGGATATATATGG - Intergenic
1037676668 8:21057083-21057105 AGGAAGGGAGTGGCAATGGAAGG + Intergenic
1038340316 8:26680496-26680518 AGGAAGGAAGAGGGGAGGGAGGG - Intergenic
1038340361 8:26680702-26680724 AGGAAGGAAGAGGGGAGGGAGGG - Intergenic
1038460213 8:27709809-27709831 GGAAAGGAAGTGGGGATAGTGGG - Intergenic
1038946034 8:32361311-32361333 AGGAAGGGAGCGGGTAGAAAAGG + Intronic
1039954529 8:42196861-42196883 AGGAAGGAAGGGGGTAGGAAGGG + Intronic
1040011639 8:42666036-42666058 AGGAAGGATGTGGGCAGAAAAGG + Intergenic
1040468770 8:47719025-47719047 AGGAAGGGAGTGGGTACTGGGGG + Intronic
1040590376 8:48787432-48787454 AGGAAGTCAGTGGGTATGCATGG - Intergenic
1040956422 8:52984198-52984220 ATGAAGGAAGTTGATTTAGATGG - Intergenic
1041606980 8:59793129-59793151 AGGAAGGAGGTGGGAAGAGTGGG + Intergenic
1041669057 8:60475047-60475069 TGGAAGGAAGTGAGGAAAGAAGG - Intergenic
1041746149 8:61211315-61211337 AGGAAGGAAAGGGGAAGAGAAGG - Intronic
1042100607 8:65271728-65271750 AGTAGGAAAGTTGGTATAGATGG + Intergenic
1042120614 8:65484052-65484074 AGGAAGGAGGTGGGTTCAGTTGG + Intergenic
1042723432 8:71847890-71847912 AGGAAGGAAGTGGCAACAAATGG - Intronic
1042868947 8:73380228-73380250 AGGAAAGAAGTGTGTGAAGAAGG + Intergenic
1043025914 8:75068578-75068600 AGGAAAGAAAAGGGTATAGAAGG + Intergenic
1045345878 8:101292901-101292923 AAGAAGGGAGTGGGTACAAATGG + Intergenic
1045445538 8:102259306-102259328 AGGCAGGAAGTGGGGAGGGAAGG + Intronic
1046092941 8:109524800-109524822 AGGAAGGAAGGAGGGATGGAGGG - Intronic
1046153948 8:110263259-110263281 AGGAAGGAAGGAAGTAGAGAAGG - Intergenic
1046552582 8:115734992-115735014 AGGAAGGAAGGGAGGAAAGAAGG - Intronic
1046638139 8:116695610-116695632 AGGAAGGTATTGGGGATAGGAGG + Intronic
1047718818 8:127619920-127619942 ATGAAGGAAGGGGGTACAGGTGG + Intergenic
1047767762 8:128003258-128003280 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1047938721 8:129807018-129807040 AGGAAGGAAATTGGTGTTGAGGG + Intergenic
1048249897 8:132855406-132855428 AGGAAGGAAGGTGGGAGAGAGGG - Intergenic
1048276211 8:133067877-133067899 AGGAAGGAAGTATGTATGGAAGG + Intronic
1048331922 8:133476438-133476460 AGGAAGGGTGTTGGTATAGCGGG + Exonic
1048363088 8:133715056-133715078 AGGAAGGAAGAGAGGAAAGAAGG - Intergenic
1048830223 8:138469095-138469117 AGGAAGGAAGGAGGGAAAGAAGG + Intronic
1048851467 8:138649481-138649503 TGGTAGGAAGTGGGTATCTATGG - Intronic
1048948114 8:139469448-139469470 GGGAAGGAAGTGGGCCTTGACGG - Intergenic
1048989600 8:139753415-139753437 AGGAAGGAAAGGGGGATAGATGG - Intronic
1049306065 8:141904969-141904991 AGGAGGGAAGTGGGGAGTGATGG - Intergenic
1050289758 9:4141296-4141318 AGGAAGGCAGTGGGGGTAAAAGG + Intronic
1050407134 9:5321592-5321614 AGGAAGGAAGGAGGGATGGAGGG + Intergenic
1051148569 9:14056774-14056796 AGCAAGGCAGTGAGTAGAGAAGG - Intergenic
1051796141 9:20872584-20872606 AGGAAGGAAGGAGCTATGGAGGG - Intronic
1051838301 9:21365337-21365359 AGGAAGGAATGGTGTATGGAGGG - Intergenic
1051956043 9:22695006-22695028 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1052556460 9:30024415-30024437 AGCAAGGAAGCAGCTATAGATGG - Intergenic
1053102745 9:35384785-35384807 AGGGAGGAAATAGGTATAGTAGG + Intronic
1054878541 9:70121668-70121690 AGGATGAAACTAGGTATAGATGG - Intronic
1055142342 9:72889838-72889860 AAGAAGGAAGGTGGTACAGAGGG - Intergenic
1055166328 9:73199733-73199755 AGGAAGGAGATGGGGAAAGAGGG + Intergenic
1055322957 9:75100086-75100108 ATGTAGACAGTGGGTATAGAAGG + Intronic
1055430351 9:76237275-76237297 AGGAAAGAAGAGGGTTTGGAAGG - Intronic
1055497090 9:76866733-76866755 AGGAAGGAAGTGGGTAAGAAAGG + Intronic
1056211154 9:84366870-84366892 AGCCAGGAAGTGGTTACAGAAGG - Intergenic
1057908735 9:99002180-99002202 AGGAGGGAAGTGGGAAGAGGAGG - Intronic
1057944565 9:99314125-99314147 AGGAAGGAAGGAAGTAAAGAAGG - Intergenic
1057953455 9:99388231-99388253 AGGAAGGAAGGAGGAAAAGAAGG - Intergenic
1058046078 9:100358441-100358463 AGGTAGGAAGTGGTTATAGTGGG - Intergenic
1058129045 9:101228543-101228565 AAGAAGGAATTAAGTATAGAGGG + Intronic
1058345007 9:103950814-103950836 AGGAAGGAAGGAGGGAAAGAAGG + Intergenic
1058542121 9:106022335-106022357 AGAATGGAAATGGGCATAGAAGG + Intergenic
1058572758 9:106365442-106365464 TGGAAGGAGGTGGGTTTACAAGG + Intergenic
1058915490 9:109560644-109560666 AGGAAGGGATTGGGTAGAGTTGG + Intergenic
1059316915 9:113433744-113433766 AGGAAGGAAGGGAGGAAAGAAGG - Intergenic
1059452407 9:114378692-114378714 AGGAAGGATGGCGGGATAGATGG - Intronic
1059599720 9:115763609-115763631 ATGAAGAGAGTGGGTATATAAGG - Intergenic
1059669674 9:116480143-116480165 AGGGAGGAAGTGGGAAAGGAAGG + Intronic
1059750727 9:117244770-117244792 AGGAGGGAAGGAGGGATAGAGGG + Intronic
1059831850 9:118104931-118104953 AGGAAGAAAGTGTATATAGATGG - Intergenic
1059994639 9:119896849-119896871 AGGAAGGAAGGAAGTAAAGAAGG + Intergenic
1060732601 9:126047967-126047989 AGGGAGGCGGTTGGTATAGACGG + Intergenic
1061312672 9:129774531-129774553 AGGAAGGAAGGGGAGAGAGAAGG + Intergenic
1062303192 9:135887407-135887429 AGGAAGGAAGTGAGAACAGCGGG + Intronic
1062703967 9:137924363-137924385 AGGAAGGAGGAGGGGAAAGAGGG - Intronic
1202802106 9_KI270720v1_random:9552-9574 AGGAAGGAAGTAGGGAGGGAGGG - Intergenic
1203368265 Un_KI270442v1:277151-277173 AGGAAGGAAGGGGACAAAGAAGG - Intergenic
1185593017 X:1291223-1291245 AAGAAGGAAGGAGGTAAAGAGGG - Intronic
1186019167 X:5234996-5235018 AGGAAGGAAGGAGGAAGAGAGGG - Intergenic
1186095063 X:6091875-6091897 AGGAAGGAAGGAAGTAAAGAAGG - Intronic
1186145780 X:6622099-6622121 AGGAAGGAAGAAGGAATGGAGGG + Intergenic
1186845241 X:13524241-13524263 AACAAGGGAGTGGGTATTGATGG + Intergenic
1187264505 X:17718774-17718796 AGGAAGGAAGGAGGGAAAGAAGG + Intronic
1187591899 X:20725885-20725907 AGGAAGGCTGTGAGGATAGAAGG - Intergenic
1187704298 X:21993985-21994007 AGGAAGGAAGGGGGAAAGGAGGG - Intronic
1187841831 X:23496806-23496828 AGGAAGGAGGGAGGAATAGAGGG - Intergenic
1188049703 X:25469840-25469862 AGGAAGGAATTTGGTATTGGGGG - Intergenic
1188517068 X:30999104-30999126 AGGAAGGAAGGGGGAAGGGAAGG - Intergenic
1188716342 X:33463963-33463985 AGGAAGGAAGAGAGAATAGTGGG - Intergenic
1188734465 X:33695674-33695696 AGAAAGGATGTGTGTATTGAAGG - Intergenic
1189197095 X:39162044-39162066 AGGAAGGAAGTGAGGATGCAGGG - Intergenic
1189278623 X:39805216-39805238 AGCAAGGAGGAGGGAATAGAGGG + Intergenic
1189369285 X:40414896-40414918 AAGAAGGCAGTGGGTAAGGAGGG + Intergenic
1189588232 X:42483881-42483903 AGATAGGAAGTAGGTATAGTGGG + Intergenic
1190746547 X:53326564-53326586 AGGCAGCAGGTGGGTAAAGAAGG - Intergenic
1191277174 X:58613946-58613968 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191279013 X:58638467-58638489 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191292385 X:58817259-58817281 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191296062 X:58866631-58866653 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191296994 X:58878971-58878993 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191303738 X:58968792-58968814 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191316026 X:59132962-59132984 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191317402 X:59151136-59151158 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191317558 X:59153193-59153215 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191318177 X:59161426-59161448 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191321260 X:59202563-59202585 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191331510 X:59340205-59340227 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191333631 X:59368669-59368691 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191344923 X:59519228-59519250 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191348624 X:59568594-59568616 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191355791 X:59664577-59664599 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191358849 X:59705208-59705230 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191370378 X:59859496-59859518 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191373580 X:59902350-59902372 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191373742 X:59904407-59904429 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191376487 X:59940923-59940945 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191379087 X:59975904-59975926 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191380636 X:59996483-59996505 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191383671 X:60036918-60036940 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191391742 X:60144918-60144940 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191393732 X:60171658-60171680 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191398484 X:60235419-60235441 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191406773 X:60346305-60346327 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191409364 X:60381269-60381291 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191409513 X:60383327-60383349 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191417429 X:60489076-60489098 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191424347 X:60581719-60581741 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191428332 X:60635201-60635223 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191444794 X:60855646-60855668 AGGAAGGAACTTCGTATAAAAGG + Intergenic
1191455760 X:61002225-61002247 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191458050 X:61033090-61033112 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191460354 X:61063945-61063967 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191463759 X:61109203-61109225 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191471151 X:61208438-61208460 AGGAAGGAACTGCATATAAAAGG + Intergenic
1191472390 X:61225071-61225093 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191473599 X:61241358-61241380 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191487341 X:61425491-61425513 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191489937 X:61460128-61460150 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191490845 X:61472470-61472492 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191501242 X:61610980-61611002 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191505683 X:61670300-61670322 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191509985 X:61727861-61727883 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191513635 X:61777064-61777086 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191530994 X:62009206-62009228 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191534985 X:62062348-62062370 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191555733 X:62340161-62340183 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191560337 X:62401532-62401554 AGGAAGGAAGTTCATATAAAAGG + Intergenic
1191665012 X:63693055-63693077 AGGAAGGTTGTGGGGAGAGAAGG + Intronic
1191915969 X:66201441-66201463 AGGAAGAAAAAGGATATAGAGGG - Intronic
1191972640 X:66833583-66833605 AGCCAGGAAGTGGTTATAGTAGG + Intergenic
1193042777 X:77021258-77021280 AAGAAGGAATTTGGTATATAAGG - Intergenic
1193490293 X:82141676-82141698 AGGAAGGTACTGGGTTCAGATGG - Intergenic
1193928258 X:87518006-87518028 AGGAAGGATATGAGCATAGAGGG + Exonic
1194760972 X:97795566-97795588 AGGAAGGAAGGAGGGAGAGAGGG - Intergenic
1195080956 X:101369931-101369953 AGGAAGGAAGAGGAGATAGACGG - Intronic
1195658804 X:107358737-107358759 AGGAAGGAAGAAGGGAGAGAGGG + Intergenic
1195700640 X:107703051-107703073 AGGAAGGAAGGAGGGAAAGAAGG - Intergenic
1195927402 X:110039509-110039531 AGGTAGGAATGGGGGATAGATGG + Intronic
1196395222 X:115253771-115253793 AGGAAGGAAGAAGACATAGAAGG + Intergenic
1198229173 X:134673290-134673312 AGGAAGGAAGGAGGGAGAGAAGG + Intronic
1198426186 X:136522720-136522742 AGGAAAGAAGGGGGGATAGCCGG + Intergenic
1198723418 X:139649780-139649802 AGGAAGGAAAGGTGTAGAGAGGG + Intronic
1199247771 X:145626152-145626174 AGAAAGGAAGTGGTTACAGTAGG + Intergenic
1200252587 X:154561599-154561621 GGGAAGGAAGGGGGTAGAGTTGG + Intronic
1200265180 X:154642817-154642839 GGGAAGGAAGGGGGTAGAGTTGG - Intergenic