ID: 942930463 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:181486432-181486454 |
| Sequence | CTGGCTGCAGAGCTGGAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942930458_942930463 | -7 | Left | 942930458 | 2:181486416-181486438 | CCAAACCCAACAGAGGCTGGCTG | No data | ||
| Right | 942930463 | 2:181486432-181486454 | CTGGCTGCAGAGCTGGAGCAGGG | No data | ||||
| 942930455_942930463 | 30 | Left | 942930455 | 2:181486379-181486401 | CCACGGTATTTAACTATCAGTAC | No data | ||
| Right | 942930463 | 2:181486432-181486454 | CTGGCTGCAGAGCTGGAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942930463 | Original CRISPR | CTGGCTGCAGAGCTGGAGCA GGG | Intronic | ||
| No off target data available for this crispr | |||||