ID: 942930463

View in Genome Browser
Species Human (GRCh38)
Location 2:181486432-181486454
Sequence CTGGCTGCAGAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942930458_942930463 -7 Left 942930458 2:181486416-181486438 CCAAACCCAACAGAGGCTGGCTG No data
Right 942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG No data
942930455_942930463 30 Left 942930455 2:181486379-181486401 CCACGGTATTTAACTATCAGTAC No data
Right 942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942930463 Original CRISPR CTGGCTGCAGAGCTGGAGCA GGG Intronic
No off target data available for this crispr