ID: 942938975

View in Genome Browser
Species Human (GRCh38)
Location 2:181594035-181594057
Sequence GTGATAAGGATTAAATGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942938971_942938975 26 Left 942938971 2:181593986-181594008 CCTTAGCCATCTGTGAGGATTAA No data
Right 942938975 2:181594035-181594057 GTGATAAGGATTAAATGAGTTGG No data
942938973_942938975 -7 Left 942938973 2:181594019-181594041 CCACAATAAAAGTGCTGTGATAA No data
Right 942938975 2:181594035-181594057 GTGATAAGGATTAAATGAGTTGG No data
942938972_942938975 20 Left 942938972 2:181593992-181594014 CCATCTGTGAGGATTAAAAAATA No data
Right 942938975 2:181594035-181594057 GTGATAAGGATTAAATGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942938975 Original CRISPR GTGATAAGGATTAAATGAGT TGG Intronic
No off target data available for this crispr