ID: 942942315

View in Genome Browser
Species Human (GRCh38)
Location 2:181632817-181632839
Sequence TAAATGGCCTGCTCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942942310_942942315 26 Left 942942310 2:181632768-181632790 CCTTGGATAGGGTAGTGGGGACA No data
Right 942942315 2:181632817-181632839 TAAATGGCCTGCTCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942942315 Original CRISPR TAAATGGCCTGCTCCTCAGG AGG Intronic
No off target data available for this crispr