ID: 942946735

View in Genome Browser
Species Human (GRCh38)
Location 2:181681352-181681374
Sequence TTTTCTGTACTGAAGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942946735 Original CRISPR TTTTCTGTACTGAAGGAACT GGG (reversed) Intergenic
904516918 1:31063209-31063231 TTTTGTTTAGTGAAAGAACTTGG - Intronic
907910767 1:58824297-58824319 TTTCCTGAACAGAAGAAACTGGG + Intergenic
908941101 1:69435290-69435312 TCTTCTGTTTTGAAGGAGCTGGG - Intergenic
910210036 1:84783243-84783265 TTTTCTGGTCAGAAGAAACTTGG - Intergenic
910442627 1:87268074-87268096 TTTTCTGTGCAGAAGGAATGAGG + Intergenic
911230134 1:95352401-95352423 TTTTTTTTACTGAGGCAACTGGG - Intergenic
912432031 1:109633033-109633055 TCTTCTGAACTGAAGGGCCTTGG - Intergenic
913576629 1:120181852-120181874 TTTTCTGTCCTGAAAGAGTTTGG - Intergenic
913613039 1:120527214-120527236 TTTTATCTACTGATGGACCTAGG - Intergenic
914558537 1:148793287-148793309 TTTTCTGTCCTGAAAGAGTTTGG - Intergenic
914614298 1:149336943-149336965 TTTTCTGTCCTGAAAGAGTTTGG + Intergenic
914838452 1:151227933-151227955 TTTACTGAGCTGAAGAAACTGGG + Intronic
916498737 1:165368458-165368480 TTTTCTCTAATCAAGCAACTGGG + Intergenic
917312255 1:173690126-173690148 TCTTAGGTACAGAAGGAACTGGG + Intergenic
917946996 1:179984287-179984309 TTTTCTGTATGTAAGGAATTTGG + Intronic
918493057 1:185103604-185103626 TTTTCTCCACTGAATGATCTTGG + Intergenic
918687565 1:187437461-187437483 TTTTCTGTTATGAAAGAACCAGG + Intergenic
918694359 1:187525211-187525233 AATTCTGTATTGAAGCAACTTGG + Intergenic
918699539 1:187590493-187590515 TTTTGTGTATTGTAGGAATTTGG + Intergenic
919779875 1:201214947-201214969 TTAGCTGGCCTGAAGGAACTGGG + Intronic
919799865 1:201347401-201347423 TTTTCTGCACTGAAGTAAGTTGG - Intergenic
920684196 1:208096669-208096691 TTCTCTATACTGAGGGAGCTGGG - Intronic
920719910 1:208377488-208377510 GTTTTTGTACAGAAAGAACTGGG + Intergenic
921373500 1:214449650-214449672 TTTTTTGTACAGGAAGAACTTGG + Intronic
922684271 1:227627066-227627088 TTTTTTCTCCTGAAGGAGCTTGG + Intronic
923484943 1:234420314-234420336 TTATCTGTACTGTAGAAACCAGG - Intronic
924479729 1:244417745-244417767 TTTTCTGTTCTGTAGGAAATTGG - Exonic
1062775558 10:143511-143533 TTTTTTGTATTGCAAGAACTGGG - Intronic
1063305421 10:4894768-4894790 TTTTGTGTGCTGGAAGAACTGGG + Intergenic
1063958408 10:11285911-11285933 ATTTTTGTCCTAAAGGAACTTGG + Intronic
1065042846 10:21715273-21715295 TTTTCTGTGCTGAACTATCTGGG - Intronic
1066015262 10:31235010-31235032 TTTTCTGTAGTGATGAAATTTGG - Intergenic
1066428780 10:35333460-35333482 TTTTCTGTCCTAAAGGAAGCTGG - Intronic
1067398492 10:45947976-45947998 TTTTCTTTTCTTAAGGAACTTGG - Intergenic
1067866805 10:49917059-49917081 TTTTCTTTTCTTAAGGAACTTGG - Intronic
1068141188 10:53009329-53009351 TTTTGTCTTCTGAAGGAGCTTGG - Intergenic
1069433840 10:68362022-68362044 TTTTCTGTACTTAAAAAAGTGGG + Intronic
1070558661 10:77549385-77549407 TTTTCTGTGATGATTGAACTAGG - Intronic
1071195611 10:83155627-83155649 TTTTCTGAACTGTGGGAATTTGG + Intergenic
1071940526 10:90586739-90586761 TTTTCTGTCCTCAAGGAGCATGG + Intergenic
1073710872 10:106039052-106039074 TTATCTTTACTCAAGGAACTTGG + Intergenic
1076080184 10:127572718-127572740 GTTTCTGGACTGGAGGAACTAGG + Intergenic
1076171332 10:128322560-128322582 TTTTGTGAACTAAAGGAATTGGG + Intergenic
1078614050 11:12848236-12848258 TTTTCTGTACAAAAGGAATTAGG - Intronic
1080115351 11:28615765-28615787 TTTTTTGTCCCCAAGGAACTTGG + Intergenic
1080816728 11:35765122-35765144 TTTTCTGTAACGAATCAACTGGG - Intronic
1081475627 11:43427768-43427790 GTTTCTGTACTCAAGGAGCTAGG - Intronic
1082887801 11:58106473-58106495 TTTGCTGTGCTGAAGGTATTTGG + Intronic
1083020365 11:59500637-59500659 TTTGCTGTTTTGAAGGAATTAGG - Intergenic
1086068063 11:82767735-82767757 CATTCTTTACTGAAGTAACTTGG - Intergenic
1086835607 11:91617991-91618013 TTGTATGTAGTGAAAGAACTAGG + Intergenic
1088316429 11:108511468-108511490 TTTCCTGTAATGTAGGAGCTAGG + Exonic
1088741431 11:112770537-112770559 TCTTCTGTAGATAAGGAACTAGG - Intergenic
1088980996 11:114863570-114863592 GTTGCTGTACTGCAGAAACTAGG + Intergenic
1089051578 11:115550264-115550286 TTATCTGTTCTGACGGAAATTGG - Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1089687915 11:120168806-120168828 GTCTCTCTACTGAAGGGACTTGG - Intronic
1089951051 11:122526622-122526644 TATTCAGTAATGAATGAACTAGG + Intergenic
1093058708 12:14580448-14580470 TTTTCTTTACTTAAGGATCCCGG - Intergenic
1093768395 12:22991761-22991783 TTTGCTTTACTGAAGGACTTGGG + Intergenic
1093974246 12:25403386-25403408 TTTTCTGTACTGAAAGCTTTAGG + Intergenic
1095387177 12:41664692-41664714 TTTTTTGTACAGAAGAATCTAGG + Intergenic
1096721164 12:53523294-53523316 TTTTCTGTAGTGCAGTGACTGGG + Exonic
1098210284 12:68156652-68156674 TTTTCTACTCTGCAGGAACTGGG - Intronic
1098890700 12:76007807-76007829 ATTCCTGTTCTGAAGGAATTTGG - Intergenic
1098990019 12:77055576-77055598 TTTTATTTAATGAAGGAATTTGG - Intronic
1099266881 12:80458604-80458626 TTTTATATTCTGAAGGATCTTGG + Intronic
1099703048 12:86113675-86113697 TTGTCTGTATTCAAGAAACTTGG + Intronic
1099988510 12:89697771-89697793 TTTTCTACTCTGAAGCAACTAGG + Intronic
1102363353 12:112308866-112308888 TTTTGTGTACTGCCGGAACGAGG - Exonic
1103078230 12:118002537-118002559 TGCTCTGAACTGAAGAAACTTGG - Intergenic
1104597232 12:130128146-130128168 TTTTCTGTCCTGCTGGGACTGGG + Intergenic
1106717308 13:32404919-32404941 TTTTCTAAACTCAAGGAAATGGG - Intronic
1106993159 13:35448609-35448631 TTTCCAGTCATGAAGGAACTTGG + Intronic
1108828592 13:54448749-54448771 TTTTATGGACCTAAGGAACTTGG + Intergenic
1109164353 13:59015240-59015262 TTTCTTTTACTGAAGGAGCTTGG - Intergenic
1109298693 13:60567461-60567483 TTTTTTTTACTTAAGAAACTTGG + Intronic
1109388439 13:61664382-61664404 TTGTCTTTACTGAGGGAAATTGG - Intergenic
1109729840 13:66397998-66398020 TTTTCAGTTCTGAATTAACTAGG - Intronic
1110373154 13:74762022-74762044 TGTTCTGCAGTGAAGGAGCTTGG + Intergenic
1112146232 13:96703678-96703700 TTTTCTGTTTTAAAGGAGCTTGG + Intronic
1112812251 13:103232441-103232463 TTTTCTACACTGAAGGAAACTGG - Intergenic
1113002530 13:105658951-105658973 TTTTCTTTACCAAAGTAACTGGG - Intergenic
1113511501 13:110858849-110858871 ATTTATTTGCTGAAGGAACTAGG + Intergenic
1114388149 14:22277348-22277370 TTTTCTGTATGGAAAGAACTTGG - Intergenic
1114835583 14:26199461-26199483 TTTTCTTTTCTGGAGGCACTGGG - Intergenic
1115116236 14:29883344-29883366 TTTTCTGTATTGAAAGAAACTGG - Intronic
1115898089 14:38113229-38113251 ATTTATTTACTGAAGGAGCTGGG + Intergenic
1116757953 14:48971407-48971429 TTGTCTGTGCTGCAAGAACTGGG + Intergenic
1116875568 14:50107817-50107839 TTTTCTGAACTAAAAGAGCTGGG + Intergenic
1118203277 14:63697558-63697580 GTTGCTGTTCTCAAGGAACTTGG + Intronic
1118412368 14:65494840-65494862 TTTTTTATACTTAAGGAAGTGGG + Intronic
1118506440 14:66418089-66418111 CTTTCTGTACTGAGAGAAGTTGG - Intergenic
1119055050 14:71410856-71410878 TTTTCTGTACCAAAGGAAAAGGG - Intronic
1119083167 14:71716083-71716105 TTTTCTTTACTGCAGTCACTTGG + Intronic
1119288587 14:73476218-73476240 TTTTCTGTTGTGAAGAAACTTGG + Intergenic
1120716095 14:87842181-87842203 TTCTCTGTCCTGAAGGAGGTAGG - Intronic
1121872389 14:97420003-97420025 TATTCTGTACTGATTGAACATGG + Intergenic
1123003956 14:105312497-105312519 TTTTCTTTAAAGCAGGAACTTGG - Exonic
1124989477 15:34657281-34657303 TTTTCTGCTCTCAAGGAACACGG + Intergenic
1126028021 15:44467199-44467221 TGTTCTCCACTAAAGGAACTAGG + Intronic
1126364193 15:47877029-47877051 TTTTCTGTTCTAAAGGAAAATGG - Intergenic
1126646638 15:50881538-50881560 TTGTCTCTACTTAAGGAAGTTGG + Intergenic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1129897004 15:79115834-79115856 TTTTCTGAAGTCTAGGAACTGGG - Intergenic
1130802943 15:87285244-87285266 TTTTCTCTATTGAATGATCTTGG - Intergenic
1130823588 15:87520364-87520386 TGTTCTGTACAGAATGGACTGGG + Intergenic
1134387290 16:13785652-13785674 TCTTCAGAACTGCAGGAACTGGG + Intergenic
1134434364 16:14242185-14242207 TTTTCTGTAATGAAAGAATTTGG + Intronic
1135490233 16:22903241-22903263 GTTTTTGTACTGAGGAAACTAGG - Intronic
1137643616 16:50055537-50055559 TGTTCTTTAATGAAGGAACTGGG + Intergenic
1138071410 16:53996516-53996538 GTTTCTATCCTTAAGGAACTTGG + Intronic
1138803863 16:60069571-60069593 TGTTCTGTGCAGAAGGAAGTTGG + Intergenic
1140014976 16:71173866-71173888 TTTTCTGTGCTGGAGAAAATAGG - Intronic
1141814926 16:86403305-86403327 TTTTCAGTTTTGAAGGACCTAGG - Intergenic
1142511340 17:395635-395657 CTTTCTGACCTCAAGGAACTTGG + Intergenic
1143223060 17:5278670-5278692 TCTTATGTTCTGAAGGAAATTGG - Intergenic
1145070837 17:19806179-19806201 TATTCTGTTGTTAAGGAACTTGG - Intronic
1146665026 17:34694457-34694479 TTTTCTGTATTGAAAAGACTTGG - Intergenic
1148076656 17:44940730-44940752 TTTTCTTTGCTGAATGACCTTGG - Intronic
1148554724 17:48571499-48571521 TTGTCTGGAGTGAAGGAAATGGG + Intronic
1149811837 17:59682257-59682279 TTTTCTATACTTAGGAAACTGGG + Exonic
1150363089 17:64555129-64555151 TTTTCTGTCCAGAAAGAACTAGG - Intronic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1155730110 18:29146271-29146293 TCTTTAGTACTGAAGGCACTAGG + Intergenic
1157456870 18:47839176-47839198 TTTTCTGTACAGTATGAAATTGG - Exonic
1157514577 18:48301791-48301813 TTTGCTGTCTTGAAGGAACTGGG + Intronic
1161992855 19:7694816-7694838 ATTACTGTACGGTAGGAACTGGG - Intronic
1165287001 19:34850937-34850959 TTTTCTCTAGTGAAAGAACCAGG - Intergenic
1167123130 19:47531016-47531038 TTGCCTGTACTGTAGGCACTGGG - Intronic
1168044608 19:53785563-53785585 TTTTCATTGATGAAGGAACTAGG + Intergenic
925815722 2:7746399-7746421 TTTTTTTAACTTAAGGAACTAGG + Intergenic
925959368 2:9001679-9001701 TTTTCAGTACTGAAGTAAGCAGG - Intronic
929446105 2:42002660-42002682 TTTTGTGAGCTGAATGAACTAGG + Intergenic
932720207 2:74133258-74133280 TGTTCATTACTGAAGGAACACGG - Intronic
932842576 2:75097285-75097307 TGTTCTACAATGAAGGAACTAGG + Intronic
935389000 2:102530803-102530825 TTTTCTTTATTGAAAGAAGTTGG + Intronic
938899018 2:135782658-135782680 TTGCCTGTACTGATGGAAGTTGG + Intronic
939455193 2:142425234-142425256 TTTTATTTATTGAAGTAACTGGG + Intergenic
940070170 2:149678119-149678141 TTTTCTGTTCTCAAGGAACACGG - Intergenic
942946735 2:181681352-181681374 TTTTCTGTACTGAAGGAACTGGG - Intergenic
944295350 2:198055192-198055214 TTTCCTGTTTTGTAGGAACTTGG + Intronic
946604657 2:221390135-221390157 TTTTGTGTACTGAAGAAAACTGG + Intergenic
946844240 2:223845118-223845140 TTTTATGTCCTGAATCAACTTGG - Intergenic
947211492 2:227712864-227712886 TTATCTGTAGTGATGGAAATCGG + Intronic
1169100824 20:2947096-2947118 TTCTCTGCTTTGAAGGAACTTGG + Intronic
1170272426 20:14542462-14542484 TTCTATGTACTGAAGGAGTTTGG + Intronic
1171356304 20:24548003-24548025 TTTTCTTCACTGAAGGAAGAAGG + Intronic
1173212784 20:41049775-41049797 TCTTCTGTCCTTAAGGAAGTTGG - Intronic
1174659049 20:52194604-52194626 ATTTTTGTACTGAAGAAAATGGG - Intronic
1176965964 21:15211793-15211815 TGTTCTGTACTGAATGGCCTTGG + Intergenic
1178330624 21:31687683-31687705 CTTTGTGTCCTGAAGAAACTTGG - Intronic
1178928832 21:36799275-36799297 TTTTCTCCACTGAATGACCTTGG + Intronic
1179287377 21:39989427-39989449 TTGTCTGGACTGGAGGAACTTGG - Intergenic
1181384652 22:22535213-22535235 TTTTCTTGACAGAAGGAGCTAGG - Intergenic
1182375778 22:29846740-29846762 TTGTCACTACTGGAGGAACTAGG + Intergenic
1182617427 22:31597067-31597089 TTTTCAGTACTGAAGCCATTTGG - Intronic
1203294510 22_KI270736v1_random:28752-28774 ATTTCTGTGCTGAAGTAGCTGGG - Intergenic
949270492 3:2210783-2210805 TTTGATGTATTGAAGGAAATGGG - Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
950334870 3:12185611-12185633 TTTTTTGTACTGATCCAACTGGG + Intronic
951116949 3:18874841-18874863 TTATCTGAACAGAAGGAACAAGG - Intergenic
953671588 3:44967254-44967276 TTTTCTGAAATGAAGGACATTGG - Intronic
955416741 3:58699298-58699320 TTTTCTTTACTGAAAGACTTAGG + Intergenic
956116897 3:65927993-65928015 TTATGTATACTGAAGGGACTTGG - Intronic
956327279 3:68067906-68067928 CTTACTCTAATGAAGGAACTAGG + Intronic
957509867 3:81173696-81173718 TTTTCTATACTGAATGTAGTTGG - Intergenic
959410483 3:106015181-106015203 TTTTCTGATCAGAAGGTACTGGG - Intergenic
959834354 3:110900999-110901021 TTTTCTGTAATTACAGAACTGGG + Intergenic
960236560 3:115289755-115289777 TTTTCTTTTCTGTAGGAACAGGG + Intergenic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
964091386 3:152880049-152880071 TGTTCTGGACAGAAGGGACTAGG - Intergenic
965337658 3:167447835-167447857 ATTGCTGTGCTCAAGGAACTTGG - Intronic
966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG + Intergenic
968562492 4:1291703-1291725 CATTGTGTATTGAAGGAACTAGG + Intronic
971306419 4:25486153-25486175 TCTTCAGTCCTGAATGAACTAGG + Intergenic
972606647 4:40619772-40619794 TTTAGTGTTCTGAAGGAACCAGG - Intronic
975894213 4:79067174-79067196 TTTCTTCTACTCAAGGAACTAGG + Intergenic
977283671 4:95074101-95074123 TTTTTTTTACTGAAGATACTTGG + Intronic
978227950 4:106361242-106361264 TTTTGTGTACTAAATTAACTTGG + Intergenic
979435837 4:120689057-120689079 TTTACTGCACTGATGCAACTCGG + Intronic
979606461 4:122643827-122643849 AGTTCTGTGGTGAAGGAACTAGG - Intergenic
980408512 4:132384101-132384123 TTTTCTGTAGTGAAATATCTTGG + Intergenic
980430599 4:132688978-132689000 CTTTCTCTACTAAAGGAACTAGG - Intergenic
980872382 4:138625105-138625127 TTTTTTCTCCTGAAGGAGCTTGG + Intergenic
981612529 4:146610222-146610244 TTTTCCATACTGAAGAAAATAGG - Intergenic
984186104 4:176545787-176545809 TTTTCTGTATTTTAGGAATTGGG + Intergenic
986731130 5:10635854-10635876 TTTGCTGAACTGAAGGGGCTAGG + Intronic
986922237 5:12700301-12700323 TATTCTCTACTGAAGGAAGGAGG - Intergenic
987758961 5:22134058-22134080 TTATCTGAACTGAAGCATCTTGG - Intronic
988286209 5:29219741-29219763 TTTTTTCTGCTGAAGGATCTTGG + Intergenic
988825942 5:34934895-34934917 ATTTCTCTACTCAAGGAATTTGG + Intronic
989993552 5:50799326-50799348 TTTTCTCTACTGAATGATCTTGG + Intronic
991893665 5:71367505-71367527 TTATCTGAACTGAAGCATCTTGG - Intergenic
992729716 5:79650657-79650679 GTTTCTGTACTGAGGATACTGGG + Intronic
993714156 5:91258102-91258124 TTATCTGTACTGAAGCAATTGGG - Intergenic
993805687 5:92406099-92406121 TTTTCTAAACTGAAAGTACTTGG - Intergenic
994248813 5:97512867-97512889 TTTTCTTTGCTGGAGGAACGAGG - Intergenic
994628093 5:102246536-102246558 TTTTCTGCACTGAAGCCATTAGG - Intronic
995770191 5:115661098-115661120 TTACCTGTACTGAATGAACATGG - Intergenic
996347871 5:122507154-122507176 TTCTGTGTCCTGAAGGAAATAGG + Intergenic
996652536 5:125897797-125897819 TATCATGTCCTGAAGGAACTTGG + Intergenic
997011923 5:129888557-129888579 TGTTCTGTACTGGAGAACCTAGG + Intergenic
997602299 5:135148977-135148999 GTTTCTGTTCTCAAGGAGCTTGG + Intronic
997781502 5:136663881-136663903 GTTTCTGCTCTGAAGGAACAAGG - Intergenic
998071331 5:139200108-139200130 TTATCTGTACTTATGGTACTAGG - Intronic
998321064 5:141232142-141232164 TTTAATGTACTGAAGGAAGTTGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1001421862 5:171593647-171593669 TTTCCTGTATTGAAGAAACATGG - Intergenic
1003346672 6:5275200-5275222 TTTTTTGCACTGAAGGACATTGG + Intronic
1003615285 6:7649663-7649685 TTTTCTGTAATGAAGGAGGCTGG - Intergenic
1006988869 6:38195920-38195942 TTTTCTGTACTGTTTGAACTTGG + Intronic
1008110416 6:47486503-47486525 ATTCCTGCACTGAAGGAAATGGG + Intronic
1008655039 6:53603359-53603381 TTTTCTTTACTGAAGCAATTAGG - Intronic
1008671078 6:53769506-53769528 TTTTCTGTATGGTAGGAATTGGG + Intergenic
1009441503 6:63685432-63685454 TTTTCAGTACAGAATGAGCTTGG - Exonic
1009943186 6:70313505-70313527 TTCTCTGTCCTCAAGGAAGTAGG + Intergenic
1010123525 6:72407172-72407194 TTTTATGTATTGATAGAACTTGG - Intergenic
1010353409 6:74903074-74903096 GTTTCTCTTCTGTAGGAACTTGG + Intergenic
1010416417 6:75616784-75616806 ATTTATGCACTAAAGGAACTGGG - Intronic
1014396947 6:120935556-120935578 TTTTCTGAACACTAGGAACTAGG + Intergenic
1014783085 6:125587119-125587141 TATTTTGAACTGAAGGAAATTGG - Intergenic
1015258368 6:131205989-131206011 TTTTTCTTACTGAATGAACTTGG + Intronic
1018961741 6:168454419-168454441 TTTTCAGTTCTGAATGAACCTGG - Intronic
1020604882 7:10324836-10324858 TTGTCTGCAATGAAAGAACTAGG + Intergenic
1021316340 7:19152236-19152258 TTTTCTCTATTGAATGATCTTGG + Intergenic
1021497888 7:21296588-21296610 TTGTCTGTACTCAAGGAAATAGG - Intergenic
1025273308 7:57547430-57547452 CTTTCTGGGCTGAAGGAAATAGG + Intergenic
1026450095 7:70521143-70521165 TTTTCTCCACTCAAGGAACAAGG - Intronic
1026673158 7:72406948-72406970 TTTTCAGTGCTAAAGGAAGTGGG - Intronic
1026708770 7:72718400-72718422 TATTGTGTACTGCAGGAATTAGG - Intronic
1030411902 7:109191407-109191429 TTTTCAGTATTCTAGGAACTTGG + Intergenic
1032299990 7:130677953-130677975 GTTTCTGTCTTAAAGGAACTTGG - Intronic
1032911509 7:136436759-136436781 TTTCCTTTACTGATGGCACTTGG - Intergenic
1034457211 7:151177321-151177343 TTGGCTGTAATGAAGGAAATGGG - Intronic
1034731608 7:153392034-153392056 TCTTGTGTACTTAAGGAACATGG + Intergenic
1035205622 7:157292212-157292234 TGTTCTGTTCTCAAGGACCTCGG + Intergenic
1035472373 7:159118666-159118688 CTTTCTATAATGAAAGAACTTGG - Intronic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1038532775 8:28331832-28331854 CTTTCTTTACTGATGGATCTGGG + Intronic
1040003507 8:42598977-42598999 TCTCCTGTCCTGAAGGAGCTTGG - Intergenic
1043711013 8:83419251-83419273 TTTTCCACACTGAAGCAACTAGG - Intergenic
1043877747 8:85505655-85505677 TTTTGGGTCCTGAAGGTACTTGG - Intergenic
1044363705 8:91318465-91318487 TTTTCTGTATTAAAGCAACTTGG + Intronic
1044783381 8:95767462-95767484 TTTTCTGGACTGATTGACCTAGG - Intergenic
1049950775 9:641561-641583 TACCCTGTACTGAAGAAACTCGG + Intronic
1051236991 9:15011705-15011727 TTTTATCTACTGGAGGAACCAGG - Intergenic
1051847317 9:21465857-21465879 TTTTTTGTAGAGAAGGAATTTGG - Intergenic
1052025342 9:23567827-23567849 CTTTCTGCACTGTAGGCACTGGG + Intergenic
1052189233 9:25638258-25638280 ATATATGTACTGAAGCAACTAGG + Intergenic
1052201074 9:25781021-25781043 TCTTCTGTACTGAAGGAAAAGGG - Intergenic
1055666007 9:78553776-78553798 TTTGTTGTACAGAAGGAAATTGG - Intergenic
1056487142 9:87070787-87070809 TTTTCTGTACCAAAAGAACATGG + Intergenic
1056886794 9:90450567-90450589 TTTTCTGGTCTGAATCAACTTGG - Intergenic
1057355743 9:94329563-94329585 TTTTCTTTCCTGGAGGAAATAGG + Intergenic
1057652015 9:96928063-96928085 TTTTCTTTCCTGGAGGAAATAGG - Intronic
1059094372 9:111396882-111396904 TTTTCTTGACTGAATGAAATTGG + Intronic
1061201159 9:129139282-129139304 TTTCCTCTACTGGAGGAACTGGG - Intronic
1061348896 9:130048367-130048389 TAGTCTGAAATGAAGGAACTGGG + Intergenic
1061417765 9:130456769-130456791 GTTTCTCTACTAAAGAAACTAGG - Intronic
1061634417 9:131897955-131897977 TTTTATGTGCTGAAGAAACTGGG + Intronic
1188805708 X:34586586-34586608 TTTTCTTTACTGAGTGAAATTGG - Intergenic
1189112557 X:38307533-38307555 TTTTCTTTAGTGAAAGAAATTGG + Intronic
1189540079 X:41977975-41977997 CTTTCTTCACTGAAGGAAATAGG - Intergenic
1189808322 X:44757348-44757370 TCTTCTGGACTAAAGGTACTTGG - Intergenic
1193421318 X:81285733-81285755 GTTTATCTACTGAATGAACTTGG + Intronic
1193713899 X:84913945-84913967 CTTTCTGTAATGACTGAACTGGG - Intergenic
1194505875 X:94732984-94733006 TTATCTGTACTGCAGAACCTGGG - Intergenic
1196462865 X:115947679-115947701 TCTTCTGTACTGATGGAGCCAGG - Intergenic
1198095567 X:133376780-133376802 TTCTGTCTCCTGAAGGAACTGGG + Intronic