ID: 942947034

View in Genome Browser
Species Human (GRCh38)
Location 2:181683191-181683213
Sequence GCGTCGCGATGCCGGCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947034_942947046 22 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 100
942947034_942947036 -4 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947036 2:181683210-181683232 ACGCTCAGCCAGTGCCCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
942947034_942947042 13 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947042 2:181683227-181683249 GCGAGGCTCCCAGGAGATGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
942947034_942947043 14 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947043 2:181683228-181683250 CGAGGCTCCCAGGAGATGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 159
942947034_942947041 12 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947041 2:181683226-181683248 CGCGAGGCTCCCAGGAGATGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
942947034_942947038 4 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947034 Original CRISPR GCGTCGCGATGCCGGCGCCC CGG (reversed) Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
911664785 1:100539889-100539911 GCTTCTCGCTGCCGGTGCCCTGG + Exonic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
916588205 1:166166318-166166340 GCGTCGCCATGCCGGCGTGACGG - Exonic
1064245676 10:13666036-13666058 GCGTCTGGTTGCCGGGGCCCGGG + Intronic
1089398877 11:118153072-118153094 GCCTCGCGGTCCCGGAGCCCCGG + Intergenic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1113505049 13:110810973-110810995 GCGTCGCGATGCTGGGGACGAGG + Intergenic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1122697406 14:103562753-103562775 GCGTGGCGCTGCCGGCGGCTAGG - Intronic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1131174425 15:90201235-90201257 CCCTCGCGCTGCCAGCGCCCGGG + Intronic
1132646782 16:1002922-1002944 GCGACGCGATGCCGGTGGCCTGG - Intergenic
1139775101 16:69311767-69311789 GCTTCGTGTAGCCGGCGCCCCGG + Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1152659813 17:81537032-81537054 GCGGGCCGATGCCGACGCCCCGG + Exonic
1152867943 17:82735462-82735484 GCTTCGCGCTTCCTGCGCCCGGG - Intergenic
1153457596 18:5296519-5296541 GCGTCTCGGAGCGGGCGCCCCGG + Intronic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG + Exonic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1163427140 19:17245888-17245910 GCAGCGCGAGGCCGGCGCGCGGG - Exonic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1168326111 19:55539236-55539258 GCATCGCGATGCCGACACCAGGG - Intergenic
932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG + Intronic
934763524 2:96868779-96868801 GCGGCGCGTTGCCAGCGGCCCGG - Intronic
940354007 2:152718663-152718685 GCGCCGCGGTCCCGGCACCCCGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
1169065864 20:2693756-2693778 GCGCCGCGGTGCTGGCGTCCAGG - Exonic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1181934635 22:26429644-26429666 GGGCCGGGATGCGGGCGCCCGGG - Intronic
1184620365 22:45672056-45672078 GCGGCAAGATGGCGGCGCCCAGG + Exonic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949522369 3:4868660-4868682 ACGCGGCGAAGCCGGCGCCCCGG - Intronic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952241193 3:31532837-31532859 GCGCCGCGAGGCCGGCGGACTGG - Exonic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
984964568 4:185128693-185128715 GCGTCGGGGTCCCGGCGCCGAGG - Intergenic
1001381365 5:171308666-171308688 GCTTCGCGCTGCCTGCGCGCGGG - Exonic
1006634535 6:35452533-35452555 GTGTCGCCATGCCGGGGCACGGG - Exonic
1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG + Intronic
1016034809 6:139374520-139374542 CTGTCGCGATGTCGGCGCCGAGG + Exonic
1018013850 6:159694652-159694674 GTGTCGCGATGTCGGCTCACTGG + Intronic
1034137378 7:148783272-148783294 GCGTGGCGATGCCGGGGGCCAGG - Intronic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG + Intronic
1044971455 8:97624466-97624488 TCGAGGCGATGCCAGCGCCCCGG + Intergenic
1049507117 8:143008709-143008731 GCGTGGCCAGGCCGGGGCCCTGG + Intergenic
1057432318 9:95005231-95005253 GCGGCGCGGTCCCTGCGCCCCGG + Intronic
1061129948 9:128703066-128703088 GCGTCGCGGGGCCGGGGCCAGGG - Intronic
1185877599 X:3713239-3713261 GCGTCCCCATGGAGGCGCCCGGG - Exonic
1185894151 X:3843468-3843490 GCGTCCCCATGAAGGCGCCCGGG - Exonic
1185899270 X:3881892-3881914 GCGTCCCCATGAAGGCGCCCGGG - Intergenic
1185904387 X:3920321-3920343 GCGTCCCCATGAAGGCGCCCGGG - Intergenic